Description :
From Genome Similarity Track
Location :
Scaffold_74:162044- 163762
Transcript NameFunction/comments
Phyca_LT1534128189Hypothetical protein
Phyca_LT1534128168Hypothetical protein

Sequence
1718 bases(100 bases per row)
taaactttgctatgagagcgtgtgttattcgtgcaaagttcgcaaacgaattagctttattgctctggatgggcaacttcttcgacgaaagatctcgttc
tgcacgaaatgcgtgaatgaaacgaccaaatgggacgcgaaagaagcagccagagatcaggcaacgggttatcgagcgtacaaagccttctcgacatcct
cacagtccgataccaggagcacagaaagcttgccatttttcgattgataagtgaaaaatatatattcgttctaagataatacagttcaagcgtgttgcag
tacacttttaaagcctacaagacaagagaagccctttgaggaaaggatgattcatccgatgaaaacgtacaacgcgattcggaagcaatcagtgatgtcc
gaccacggggcggcaaaacatcgttaaaaacacgaccatcgtcgattattgaactctgtactgtaagaaacaagttttcattgttcgcgttggtcgtaaa
aagtggggagggacatggttacgacccgatgcgaatacacgtacaggtacatatagcagtagtcttgacgatgtctttaggcattgtttcagtagccgca
agatattctagtagaataattctacaggtcatacatgtaaatcaaaatggcaattgcaaattgcagcaaagctcgtcgttcggacgtctgaacgttgacc
actgttcaaagctctcgacgatctgacagtcacgctcgatgcgtacgtttacggcttggaagttcccgttgtaccgggaagcgtacggatcgtatggcca
atctacctcgcacgcacgtggagtgcctcgttggtcgatcacaagattggaatggggacttacctgtttagaactgaccaaagtccgatttgcgccgtaa
gggccacagagaaactcaaggcgtgaatccgtatccagacctgcaggtttccgaggaggagcgcgttcatctcagcgaactcgtgaatggatttgtgacg
gactatttccaaaagtatgaggattttgtaagtattgacaagcgtcaggtggacgaacagcgctggaaacactacaagaccaaagacaatctccacgtgt
actcacaacgcagtcaaaaggagagtgtgactgaatcgactgagagtaaaatccctttacccttgaaggatttacccgtcgtcttgcgcgttgggacgtt
agttggtgacctggacgacctcatgtttggtgtggtgaaccctacgttggatgtgatgcgcgttaaggcttcatacgtacacgacctggacgctggttcg
atcctgtgtccgatcatcgaacctaacgaggaggaaccgttccgttcgcttattatcaaatggatgacaatcgacgccccgctgcagtccacaagtctgg
tcaaagtacgggacttcgtctacatcgaagctacagggattatccactccgagaatggcgatcgccttgggtaccatttaacccactcgatcgagtttcc
gcagacaaaacctcgaccaaacgtgatccgcggcaatctttcgtactgtggagtcttccgacaaatcgatcgaaacgttattgaagcgttcggatcgagt
actgtagcccctggaggcgatgtcatgcggtttatctctcttcgtgtggcaactgaagcacttctatcagcgaacaacctcgtgtattgcgggcaaatga
agaagttatcgtggatgt