Description :
From Genome Similarity Track
Location :
Scaffold_68:162027- 164163
Sequence
2136 bases(100 bases per row)
TGTATTAAGGCTAGTACTTTTGAGCACTGATGACACCTGATTTCTTGGATTCATTAGTCCCCTGAACCAGGGCTAGAAGCTTGCGATCTTGTTTTTTTTT
CTTAATTTAGAGTTTACTGATTCTGTGAAGACTTGATACCCTTTCAGTTTATACCAGTTTAGTTGAATACACTAAGAGACACTACGAGTCTATAAGTCTT
CCTCCGACAACTGAGTTGGGGCAGCTTTACTACACTTGGTAGCAGGCGTAGTCAATCTACATATGAGTCTATAAAATAGTAATATGTGGTGGAGTGGGAT
TCGCTCGTTTGGAGAAGCGATCTCAACTCGCCACTGGCGCCCGGACGACTAACTTACGGAGGGGGTACTCCGGACCATGTGTCTTGTCTTGTTCCTTCTC
ACCTTGTGTACCCGTCGGCGGGTGGATTGAACTCTTCTAGGTGGCTTAAGGTCGATGTGTGTCTTGACCGAGTTGGGGATAGGTTGGGTGTGGTCGCATG
AAATTCTTCACACGACCAACGGTTACTTGTGGCGCTCTCCCAGAGTCACCTGACCTTCCTTGAGGTCGACTTGCTCAAATGTGGATACTTAATCCCGTTG
TTCTTCTGACCAGTTGATCACTTTGTTCTTCTGATCACTTGAGCCGTCTGAAGACCTTTCCTTTATATGCTTGCCGCGTCCGATCGCGGGCTAACTTGAA
TGATTATCTTTGTCCCTAATCTGGGGACAAACCTTGAATAAACACGTGAGCAGAAAACCGTGAACGTCAGGTAGCCACAAGTATTCCAGCCCGGAGGGAT
GCTGACGTGTGTCTTTTGTAGGAAAATCAATACTGTTCGTTATTGACCTATTAGGAGCTAGAACTACGCTTATGCTTCTCTGTATCTTAGTTTCTCTTAT
GTAGCTCGCCCCCGCCATCCATTCTCTGTGCTTGACGTGGTCCACCTTAACCACCATGACCACTGATCGTCATCAGTGACCATGATCACGATCGTTGGTC
ATCAGTAGTGATCATGAACGATGGTCACCCACCGCGATCGCGACCGATGATCATCGCATGTGACCGCAACTGATGACCGGTCAACTTTCCACCGTACCGT
TGGAGATTTCCGGCGGTCAGTCCCAAGGCCTTCGTGGCCGGGACTACATGCGCCCGTGATGGGCAAAGATGCGATTGGTCAGGATTCAACCCGACCACTT
CATCACAGTCGTCCCTTGCTCCGGTAATTGGCAACCGATGTCGATCTGGCTGCGCACTTTTTCACTTACCTACTCCGTTCAACCGTCGCATATTTTAACA
TGCGATAGGCTCGGAGAGATGTCGCTTCCAAACCGCCCCACCGCTGATCTACCTCTGGCTTCGGGTCCAGTACCCCTTCAGCCGGCCCGCTGCGATCATC
CATCCCCATTCTTAATGGTGAAACACGTGCTGGTCATGCACTAGACGCTACCGGCGACACTGTTGCTCTCAGTGATCATAACTCGCCCCAAGTTGGCCTA
CTCTCTGATGACCCCGGACCCGCCTCAGCTGAACCCGGAATCCCTGCAACAAACCATCCCGTCGACTCGTCCGACGTTGCGGCTCTCCCCGTTGCTGTCT
CCGTGGAGTTCGGCTTGCATCGCATTGGCGTGATGGACAGAGTTCAAGAACCTCAACCTGTCGAAATCGAAGCTGTTTCAGCTGATCACCCTGTCGACCC
GGTCGGCGTCACAGCCGTGTCAGTTGACGTCCCCGCGGACTTTGACTCGCCTCCCAGTGGCGAGGTGGATGGAAACCAAGTATGCAACACGGTCGAGATT
GAAGCCGTTTCTGTTGATCACCCGTCCGACCCTGTCGACATCGCTGCTGTGTCGGTTAACGTCCCCGTTGACCTTGGCTCACCTAGCAGTGACGAGGTGG
CCGGAAATTAAGCATACAACCCCGTCGAAACCGATGCTGATACTGTTGATCACCTTGTCTACCTTGTTCGTGTAGCAGCTGTGTCTTCCGACGTTTCTGT
TGTCCTTGACTCACGTAGCGTGGACGAGGCAAACGGTGATTAAATGTCTGACTCCCGTATGACTGATCGTCCCGCCGAGCTGGTTGACCGTGCAACGGTG
TCCACCGACGTCCCTGCTGCATTTGACTCGAATAGC