Description :
From Genome Similarity Track
Location :
Scaffold_506:1620- 3163
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_506-fgenesh-gene-0.0SH2 domain containing protein

Sequence
1543 bases(100 bases per row)
AGCTTCAAGCTGCTGGGCAACGGCAACCACAGCGAGCCGCTCTTCCGTGACGTGGCCGACGGCGTCTTCGTCGACAACTCACCGCCGCTGCCGACCAACG
AGTGCGACGCCGTGGCCGAGGTCTTTGTCGGACGCTCGCTCGAAGTGCACCAGGCGTACAAGTCGCTCGTGGAAGGTGCGCGGCTCGTGAGCATCACGGG
GGAGCCTGGTGTCGGGAAGACGGAGATCGCGCTGCAGTGCGCCAACTACGCGACTGAGCGCCATGTGTTCAAGCATATTTTCTTCTTGCGCCTCGACGAC
GACGAGCACGACCACGCTGGACAGTTCAACCGCCCACCACCTCCCCAGGACGCAAACGTCTTGCTGTCAAAGCTCGCCAAGGCGCTCGGTGTCGGCGCCG
TAGACTCGAATGAGGCGCTGGCCGAGCAGATGCGGCTCCGGTGCACCGACGGCGTCTTCCTGCTCATCATCGACGGCTGCAACCGCGCCGTCCGACAGAA
CCCGTCGTTCCGGGCCGTAGTGGGCATGCTCCTGCGACGAGTCAGCTCGTTGTCGGTCATGCTCACGGGCGACGGCAAACTCGGCGCCATGGACGGCGTC
GGCGAGAAGATCGTGAGTGTGGAGTGTCTGCCGCCGTCCGACGCGGCTCTGCTCTTCACGCTGCGCGCTCCGCGCAAGATCAAGACCCACGAGATGGGCG
GAAGCGCCGATCTGGCCGCGTTCGCCGAACACCCAGTCATCAAAGCGTTGACGGGACATCCCAGAACGATCTGCGCGGTACATCCCCTCCTCGTTCTCTT
GCGTCCATTTCCTGAAATGGCGACTTTGTAGACTCACGTGATTGCTTTTGTGTCGCAGGTCTCGCAATTTCTGGAGAACAAGGACATGGAGCTGGATCAG
CACGAGTTCCTCGACTACATCATCCCGTCCGTGCTTGCCGGGCTGTGCAAGGGCAAGTTTGACCAGCGGACCGTGTGCTCGTTCGCCAGCAATCACCACC
ACTCGGACGGTGGAGACAGAGCCACTGCAGGTCACACCGAGCTGTTTGTTCACTCGCACGCGCACCACCACCATGTTCACGTTCGCCACGGCGCGCCTCC
ATTGCCAGAGCTGGGACTGCGACGCATGAAAGGCGTCGTGTCGCAGCCAAACGTGTTCGCGCCGCCGCCGTTCGGGTTGTCCGCCCACTCGCTGTCTGAG
AGTGGTGATGGAGAGCACGGAGGTGCGGCCACAGACAAGAGGCAGAGCCTGTTCTCGTCGCTGAGCGAATCCAACCTCAAAGGGTCTCTATCGTCGCCGA
CATCGCAGCAAGAGCTGTGTTGCCTCAAGCTGGTGGACCACGTCAAGTCGACGGGGATGAGCGAGGATGGCTGCTTCGTGTGGGCACACGCGATCGTCAA
GAACGTCCACGTCGACGACGGCAACTACTCGGCCGGCGTGGTGCACCGGCTGGTAGAAATCCGGCAGATGCCGCTCGACTGGGTGGCGCCGCAGATCAGC
CGCTACTTCGCGTCCAAGCTGAAGGCGGACGCGGTGAACCGGC