Description :
From Genome Similarity Track
Location :
Scaffold_1568:1620- 3115
Sequence
1495 bases(100 bases per row)
TATGTCAGATACGACTGCACTGAGTTTTGCCCAAGTGTTCGAAGAATGTGTGTACCGACGGTTCGGAGCCCCATCATTAATACGGCACGACCGCGACCCA
CGCTTCATGAGCGAGGTTTTCCAAGCATTTGCAGAGAGGATGCAGTCAAGATCACGAGCGACTTTGAGCTATCGGCCACAGGCTAATGGACAACAGGAAC
GCTCGGTGAAGTCGGTGATGGGATCCGTACGGGTGTACGCGGAAGACCCTCTACAGCAAGATTGGGACGAAATCGCGGAGAAGCTAGTATTTGCTATTAA
TACTTCTCAAGACACTACGAGGAAGGAAACGCCGTTCTACCTCGTTCATGGTTGGGATGCGCAGTCGACGTTGCGGGCAATGTCGTCATCACTCAAACGA
GGACTCGGCAAGCAGTCTGACGCACTGGCGTGGCGGCGCGAGATCAATCGACAACATGAGGTCGCCCTCACTATGACCGAAGATTATCAGGCTGTAGAAA
AGGAGCGAAGGGCTAAAAAGCATAATGAGGCCCTGAGTCGACTGGAAAAAGCTGCTGTACCTCAACCAAGTGGAAACGAACACTCGGCGAACCCTCCAGA
AGCTTCAGGAGAGATGGAAGATCCTGCAAGAGCTCCACCGAGATCTCTTTTTGAGATTGGGAGCCGGGCGTGGTTGTACATGGAACGCGTCAAACCGGGC
TTGACGAAGAAATTAGCTCACCGATGGCATGGACCTTTTCGGATCAAGCGCAAGGTGGAAGAGTTTGCGTACGAGCTGGAACTGCCTGACCGAAGTGGGT
ATCGCTTCTACCCAGTAGTGCATGTGTCGAGACTCAAGGCTGTCAACGAGTTCAACAGTCGACCGAGCACTCGGTTGGTACTAGACGCGACTAATGAAGC
GAGACTCGACTTCGATGAGGAACTGTTGCCTGAGGACAGCTGGGAACCAGATCAAGTTGCCGGTGAATATGAAGTCGAGGCCATCCTCGACGACAGAACA
CCACTGACGACGAGCACGGAGCGTGCTGTACGCGAGTTCAAGGTCAAGTGGGTGGGCTATGAAGATCCAACTTGGGAACCATCATCCAACTTGTCATGTG
GAGGTCTGCTGTACGACAATTTGCGAGCCCAGGAGAGAGCGAGATTGCGTTTGAAGATGGGCCACAATGGGCGGAAGGAAAGATCTGAGCGGGAATGAAT
CCAATTTTGAAACTTTTCCCACAAAAAATTCCACCCCTTTTTTTACCAGACGAAGAACGTTACTGCAACAACAAATTGTATATGCATTTGAAGAACAACA
TGAACATGATTACGCTGTGGAAGTGGATTAAGAATAAGAAAACATGAATGCCGACCGCGGAGCAACCACTGAAAACGAAGTCACGCGAGACACCTCAACA
GTTAGCTGAGATGCTGGAGAACGTCGTAGAACGTGCAGCGAGGACTCAAATCGATTCCAAGTGTCTGGCCGCGGTGGCCAAGAGGGTCAACGAAG