Description :
From Genome Similarity Track
Location :
Scaffold_1619:162- 1714
Sequence
1552 bases(100 bases per row)
TAGTTCCTTTTTCGGTTGCTGTTCAAATACGCTCGAAAACATTCTCTGGACGGTCGAGCTGATATCATCATCTTGATGACCCGTGTTCCGACCCTTAGCT
GACAGTAGTTGATCGAACATCTCTCCAAATGTCGTTGGTCGATCATTTTCCACATTGTTGCTCATTGTTCTATTGTCGGCCTCACTAGGTCTGACTTCTG
GTTCTCTCCCCGCTGCCGTCGATTCTCGCGCGGGCAGCTTATCGTTTTTCTTTGATGGATTATCATTCGTGGCCGTAACATCTTTCCCCGCCTGCTGTTC
GGCAACATCAACACCTTGGGTTGGCTCGTCGAGTTTAGCTGCTTGAGCTAATTTCGGCGCGGCTTGGCGCACACTCGGATCCGGATCCGGCGGATCTTCA
TGGCCCCCCATATTACGCTGCGTCTTATCAGAAGATCGCAATGCTCCAATTATAGGGTCGTATAGTTAATACAAGTCGTTTCGTCGAAGAGTCGCtgtgc
ggctgctgctgatggctAGGTGGTGTACTTCCACGCACCACAGTTGGTTATTGTGCGGCAGATCGGTGTGAACGACCGGTCGCAAATTCGGAACTGACGT
TCTCTAATAAATCTCACCACTATTTTTTGGTTGAGTGATCCTCCAGCTAGATATTGACTTTGTCGTTCGTCAGAGAGATTTCGTAGCGAAAATTCCCGTC
AGGACGCAAGGCAAACTTCGTCACTCCTTCAACCTCGAAGTCAGCCGCCGGTGCCATGGTGAAAAGGTTCAACCTCGCAAAGGAACTTGAATAATGACGT
TACCGTTTCCCGGGGAATCCGATCTCCTCGAGTGTTTCTAGGAAATCGCGGGCATAAAATAATCAACAAGATTTCTCGCTCAATTTCCCGGATAACTCAT
TTCAGCTGCCACACAGTTGATAAAAtggctgctcaagaagattcCAAAATCGAGGGGGTGACCTCATTCCCCTCTAGCCCTACTGCTAGTTATCGCTACA
CGATTTTCCTCTGGCGTGGGAAACTCAGCATTTTGCTGGCGGATCGTTCAAGCAAGAAACAATGGCACGCATTACAATTGTTGTTTTAGTACTCGTTGGT
ATTCATCTTGTTTTCCCAGGCAAACGAATTTTTTGCGCAAAGATAACTACGTGACATCTAGGAACGCGTTCGCTACAGCCACCTCGACGGACTACGCGTT
GGTAAGAAAACAAACGGGATTGCAGCTTTGCTAACAAGGTTTAGCTGGTTTTGTGCTGTCCTCTGTAGCTGTTTAAGCGGGCGTTGGACTGTTCTTTAGA
CACAACAGAGGACGTCGAGCGCAAGTTAACGTGTCTTGAAGACGACACACTTCGACTGGAGTTGTGCACAAATATTCGCCTGTTGAACGTGGCACGTCGC
ATCCGGTGTGTATTTAGACTCCAACCTCTTGCAATTGATCGTATTGGTGCTCTTTCGTCAAAACTACAAGACCAGCAAGAACTATCGATCAACTCTCCAG
CCAAGCCAAGGCTAGCTGCCCGGAACGAATGTATCTGTATGCAGAGAGCGAA