Description :
From Genome Similarity Track
Location :
Scaffold_5782:162- 1427
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_5782-snap-gene-0.1Surfeit locus 1 family protein

Sequence
1265 bases(100 bases per row)
CTTCGCGATGGATGGCCACGGTACCGGAGAGCGGAGCATCCGGCACGGCAACGTCGGCGCCAGTGGAAAGCAATTTCTCGCGCTACGCTGGCATGGCGTT
CTTCTCCGTGATCGTACGTTAGGCAACAAGGAACTCAATCGAGCAGCAACCATTTCACGAGCGATATTGGCCGTATTGTAGGTCGCTGGCACTACAACAT
TGGGCGCGTGGCAGGTGAGCACCCTGCATTCGCAGCGATACGCGTCCTAGCGAAAGGATTCTTTACGAACGTTCTCTGTAGACCCAGCGATACTTTTGGA
AGCAAGGAGTCATCGAAGAGCGCAAGAAGCAGCTTCATCAAACTATCGTCGACCTCCCCGATTATGCGACAGCTTTTAGTGATCTGTGCGTACATCGCAT
CATTGAGCACCCTATTGTGGGCTCGAGTTTGCTGAGTACTAGGAATCGTTTCGTAGGGATATCCCGGAATTCTGTCAGCTTCGAGTCGAAGGTCGATACA
AGCCGGGAAGTACATTCTACCTGTGTACGTTGGCGTCATTCCACTCGAGCTGTGGGTTTAGCTTCGTATTGACAGAGATCTGTCTGTTGACTGAACAGAT
CCGAGATCAGCGCCGGCGGAGTCGACCGACAGCGTCGCGACCCCCAAGTCCGGCGGCTACATCTACTCCCTGTTGGAGCGTGAGAATGGGTGAGTAGATG
GCATGAGGCTGGGAGCTGGTGGTGGGTATTATTCAATCAAAGGTCTTTGTGTGTTCGCCGTGCAGTTCGCCCGTGATCATCAACCGTGGATTTCTGCCTC
GAAAGCTCTTGGATATCCACATCGCTCAGCAGACAAAGGAGGAAGAGGGAGCTGTCACGATTCTTGGTGTTCTTCGCCATGGAGAACAGGTACGCGATGC
ATTTCTTGCGAATGCCAATCAACGCTGACCGATGATTCCTCCTTCTTTCAATGTCGAGCAGAAGGGCCCATTCACACCTGACAACGACCTGGAGAAACGC
CAGTTCTTCTACCTGAACCATGACCAACTCGCGGACGCCATGGGCGTAGAAGAGAGCATTTTGCCAGTGATTCTCGATGCGACAGGTGCGTTCGTGCATC
TGTAATGCCCAGCATGGCAAAACCTCACATGCAATCCACATCCGGCAGCGGCGGAAGATGAGTCGGCTCCAGCGTCACTGGACAACTTTGTGCGCAAGAA
ACTGAGCAGCTACTTGGAGTTCTACATGACTCCGGAGAAGCACGCTGGCTACGCCGCGACATGGT