Description :
From Genome Similarity Track
Location :
Scaffold_101:16199- 20655
Sequence
4456 bases(100 bases per row)
GCGTCAACCGGCTGAACCGAGTCAAAGGACGGCAAGGTGGCCTCGAGCAGCGTGTAAAAAACATGTCGTCCCGACGAGACGTAGAATAGCGTCGATGAGG
TTTTGCGGCTCAGCAAAGGCAATGAGCGGAGTCGTATCCGTGAGAGCGCTTGGAAGGATGGCGAGAGCGTATGAAGCGTGCGTTTGGGGCGTGGTTGTAG
TGGTTGCAGTGGCTGTGCGTGTGTGTGTATTTGCGTTGGGTTTGTGATTTTGAGTGCGGTTTCAATGTTCAGCCTTCCATATAGTCTAGGCGGTTAGGAT
AGCTGGCTCTCGCCCAGCAGACCCTGAATCGAGTCCCGGTGTGGGAACATCTTTTGCTTTTCTTTCTTTCTGCTTCTTCTATTTCGTCTACCTCGCACGC
TTTCTCAGCGAGATTACAACAAGCGCGTCGTAGTCACTCGGTAAGTTTCGCCTGCAAGCCCTTACACTCCTGCATGTAGTAATGCCAATCCTACCGTCTG
GGCCTTTTCACGGTGGAGTGTCGCCACTGCCATCAGCGATGACCTTCCCTCGGACGCCCACTAGCGTCAACCGGCTGAACCGAGCCAAAGGACGGCAATG
TGGCCTCGAGCAGCGTGTAATAAATATGTCGTCCCGATGAGCGATGAATAGCGTCGATGAGTTTTTGCGGCTCAGCAAAGGCAATGAGCGTAGTCGTATC
CGTGAGAGCGCTTGGAAGGATGGCGAGTGCGTATGAAGCGTGCGTTTGGGGCGTGGTTGCAGTGGTTGTGCGTGTGTATTTGCGTTGGGTTTGTGATTTT
GAGTGCGGCTTTAATGTTCAGCCTTCCATATCGTCTAGGCGGTTCGGATAGCTGGCTCTCGCCCAGCAGACCCTGAATCGAGTCCCGGTGTGGGAACATC
TTTTGCTTTTCTTTCTTTCTGCTTCTTCTCTTTCGTCTACCTCGCACGCTTTCTCAGCGAGATAACAACAAGCGCGTCATAGTCACTCGGTAAGTTTCGC
CTGTGAGCCCTTACGCTCCTGCATGTAGTAATGCCAAACCTACCGTCTGGGCCTTTTCACGGTGGAGTGTCGCCACTGTCATCAGCAATGACCTTACCTC
GGACGCCGACTAGCGTCAACCGGCTGAACCGAGCCAAAGGACGGCTAGGTGGCCTCGAGCAGTATGTAATAAATATGTCGTCCCGATAAGCGATGAATAG
CGTCGATGCGTTTTTGCGGCTCCGCAAAGGCAATGAGCGGAGTCGTATCCGTGAGAGCGCTTGGAAGGATGGCGAGTGCGTATGAAGCGTGCGTTTGGGG
CGTGGTTGCAGTGGCTGTGCGTGTGTGTATTTGCGTTGGGTTTGTTATTTTGAGTGCGGTTTCAATGTTCAGGCTTCCAATATAGTCTAGGCGGTTCGGA
TAGCTGGCTCTCGCCCAGCAGACCCTGAATCGAGTCCCGGTGTGGGAACATCTTTTGCTTTTCTTTCTTTCTGCTTCTTCTATTTCGTCTACCTCGCACG
CTTTCTCAGCGAGATTACCACAAGCGCGTCGTAGCTACTCGGTAAGTTCCGCCTGGGAGTCCCTACGCTCCTGCATGTAGTAATGCCAATCCTACCGTCT
GGGCCTTTTCACGGTGGAGTGTCGCCACTGTCATCAGCAAAGACCTTTCCTCGGACGCCCACTTGCGTCAACCGGCTGAACCGAGCCAAAGGACGGCTAG
GTGGCCTCGAGCAGCGTGTAATAAATATGTCGTCCCGACGAGACGATGAATAGCGTCGATGAGTTTATGCGGCTCAGCAAAGGCAATGAGCGGAGTCGTA
TCCGTGAGAGCGCTTGGAAGGATGGCGAGTGCGTATGAAGCGTGCGTTTGGGGCGTGGTTGCAGTGGTTGTGCGTGTGTATTTGCGTTGGGTTTGTGATT
TTGAGTGCGGCTTTAATGTTCAGCCTTCCATATAGTCTAGCCGGTTCGGATAGCTGGCTCTCGCCCAGCAGACCCTGAATCAAGTCCCGGTGTGGGAACA
TAGTTTGCTTTTCTTTCTTTCTGCTTCTTCTATTTCGTCTACCTCGCACGCTTTCTCAGCGAGATTACCACAAGCGCGTCGTAGCTACTCGGTAAGCTCC
GCCTGGAAGTCCCTACGCTCCTGCATGTAGTAATGCCAAACCTACCGTCTGGGCCTTTTCACGGTGGAGTGTCGCCACTGTCATCAGCAAAGACCTTTCC
TCGGACGCCCACTAGCGTCAACCGGCTGAACCGAGCCAAAGGACGGCAAGGTGGCCTCGAGCAGCGTGTAATAAATACGTCGTCCCGATGACCGATGAAT
AGCGTCGATGCGTTTATGCGGCTCAGCAAAGGCAATGAGCGGAGTCGTATCCGTGAGAGCGCTTGGAACGATGGCGAGAGCGTATGAAGCGTGCGTTTGG
GGCGTGGTTGCAGTGGTTGCAGTGGCTGTGCGGGTGTGTGTGTATTTGCGTTGGGTTTGTGATTTTGAGTGCGGTTTCAATGTTCAGCCTTCCCATATAG
TCTAGGCGGTTAGGATAGCTGGCTCTCACCCAGCAGACCCGGGTTCGAGTCCCGGTGTGGGAACATCTTTTGCTTTTCTTTCTTTCTGCTTCTTCTATTT
CGTCTACCTCGCACGCTTTCTCAGCGAGATTACAACAAGCGCGTCGTAGCTACTCGGTAAGTTCCGCCTGGGAGTCCCTACGCTCCTGCATGTAGTAATG
CCAATCCTACCGTCTGGGCCTTTTCACGGTGGAGTGTCGCCACTGTCATCAGCGATGACCTTTCCTCGGACGCCCACTAGCGTCAACCGGCTGAACCGAG
CCAAAGGACGGCTAGGTGGCCTCGAGCAGCGTGTAATAAATATGTCGTCCCGACGAGACGATGAATAGCGTCGATGGGTTTTTGCGGCTCAGCAAAGGCA
ATGAGCGGAGTCGTATCCGTGAGAGCGCTTGGAAGGATGGCGAGTGCGTATGCAGCGTGCGTTTGGGGCGTGGTTGCAGTGGTTGCAGTGGTTGTGCGTG
TGTGTGTATTTGCGTTGGGTTTGTGATTTTGAGTGCGGTTTCAATGTTCAGGCTTCCAATATAGTCTAGGCGGTTCGGATAGCTGGCTCTCGCCCAGCAG
ACCCTGAATCGAGTCCCGGTGTGGGAACATCTTTTGCTTTTCTTTCTTTCTGCTTCTTCTATTTCGTCTACCTCGCACGCTTTCTCAGCGAGATTACCAC
AAGCGCGTCGTAGTCACTCGGTAAGTTTCGCCTGCGAGTCCTTACACTCCTGCATGTAGTAATGCCAAACCTACCGTCTGGGCCTTTTCACGGTGGAGTG
TCGCCACTGTCATCAGCGATGACCTTTCCTCGGACGCCCACTAGCGTCAACCGGCTGAACCGAGCCAAAGGACGGCAAGGTGGCCTCGAGCAGCGTGTAA
TAAATATGTCGTCCCGATGAGCGATGAATAGCGTCGATGAGTTTTTGCGGCTCAGCAAAGGCAATGAGCGGAGTCGTATCCGTGAGAGCGCTTGGAAGGA
TGGCGAGAGCGTATGAAGCGTGCGTTTGGGGCGTGGTTGCAGTGGTTGCAGTGGTTATGCGTGTGTGTGTATTTGCGTTGGGTTTGTGATTTTGAGTGCG
GTTTCAATGTTCAGCCTTCCCATATCGTCTAGGCGGTTAGGATAGCTGGCTCTCACCCAGCAGACCCGGGTTCGAGTCCCGGTGTGGGAACATCTTTTGC
GTTTCTTTCTTTCTGCTTCTTCTATTTCGTCTACCTTGCACGCTTTCTCAGCGAGATAACAACAAGCGCGTCATAGTCACTCGGTAAGTTTCGCCTGTGA
GCCCTTACGCTTCTGCATGTAGTAATGCCAAACTTACCGTCTGGGCCTTTTCACGATGGAGTGTCGCCACTGTCATCAGCAAAGACCTTTCCTCGGACGC
CGACTAGCGTCAACCGGCTGAACCGAGCCAAAGGACGGCAAGGTGGCCTCGAGCAGCGTGTAATAAATATGTCTTCCCGACGAGACGATGAATAGCGTCG
ATGCGTTTATGCGGCTCAGCAAAGGCAATGAGCGGATTCGTATCCGTGAGAGCGCTTGGAAGGATGGCGAGTGCGTATGAAGTGTTCGTTTGGGGCGTGG
TTGCAGTGGTTGCAGTGGTTGTGCGTGTGTGTATTTGCGTTGGGTTTGTGATTTTGAGTGCGCTTTCAATGTTCAGCCTTCCATATCGTCTAGGCGGTTC
GGATAGCTGGCTCTCGCCCAGCAGACCCTGAATCGAGTCCCGGTGTGGGAACATCTTTTGCTTTTCTTTCTTTCTGCTTCTTCTATTTCGTCTACCTCGC
ACGCTTTCTCAGCGAGATTACAACAAGCGCGTCGTAGTCACTCGGTAAGTTTCGCCTGCAAGTCCTTACACTCCTGCATGTAGTAATGCCAAACCTACCG
TCTGGGCCTTTTCACGGTGGAGTGTCGCCACTGTCATCAGCGATGACCTTCCCTCG