Description :
From Genome Similarity Track
Location :
Scaffold_287:1619- 3025
Transcript NameFunction/comments
Albla_Nc14114230conserved hypothetical protein

Sequence
1406 bases(100 bases per row)
GCTTACCGAAGCTAAAATCAGCGAATCAACTCCAAGCACCAACCACTGAAATCACAACATTGAAGTCCGGTTTACGAGTGATCTCTCAAGAAACTTACGG
TCAAGCCGCAACGATTGGCTTATTTGTTAATGCTGGAAGTCGTGATGAGGACGGTGTGTGATTCCACTAGAAATCCTCTCTCATCTGATTCCTTACACTT
TTTCTTACAGAAACCACACTTGGTGTCAGCCACATGTTGGAACATCTGGGTTTTAAGACGACTAGAAATCGTTCTCACGCACAACTGCTTCGTGAGATCG
AAACTATCGGTGCACTCACAACGGCATCGAGTGGTCGTGAACAAATTATCTACACAATCGATCTATTACGAGATAATTTGGACAAAGGAGTCGAGTTATT
GGCTGATGCCATATTAAACATAAACCCAACGTCTGATGAATTTCAATCCATAAAAATGATTATGGATTATCAGAATCAGGATATGCAGGAAAACGCACCT
GGACTCGTGCAAGAAGCTATTCACGCGGCAGCATATGGTCCGAAATCGTCTTTAGGAAGACCTGTTCACTGTTGTGATGAGCTAATCGACTCGCTCACTA
TTGAAAAAGTAAAGGCATTTCAACAGCGACATTTTGTTCCTAATAAAATGGTTCTTGCTGGTTCAGGTATTGAGCATGAGACTCTGGTCGAGCTTGGTGA
GAAATACTTTGGGTTTGTTACCGATAGTGGGAGCATCAGTATACACGATAGAAGTCAGCAATCGGTATACTTGGGACAGGTTGAGTCAATTTCGAAACCA
GACTCCACGTTCTCTTACGCCGCATTGGCGTTTCCCATTGGCGGTTGGCATAACGAAGATCTGGTACCAGTGTGCGTTCTACATACATTACTTGGAGGTG
GAGATAGTTTTTCAGCTGGTGGACCTGGGAAGGGGATGTATTCACGTCTGTATACAAGCGTGCTCAATCGCTTTCACTGGGTGGAGTCCGCATTCGCTTT
CTCCTCCATTCATAACGATGTCGGATTGATGGGAATATACGGTGCTGCAACACCCTCCCACACTAGTAATCTAGTCGCTGTTCTTTGCAATCAGTTACTG
CACATCGCTCAAGTCGTTGTGGATCCATTGGAATTATCACGGGCTAAAAATCAACTCAAATCATCTGTTTTAATGAACTTGGAGTCTCGAATGATACTTT
ATGAGGATATTGGACGGCAATTGTTGACGTATGGATATCGTGAGTCCCCTCAACGCGTCTGCGCAAAGATTGACAAGGTGACTGCAGAAGATTTACAAAG
AGTGATGAGAGAGGCAATGAGGGAGCGTCCTAGTATGGTGTACTATGGAGACCTGAAGCTGTTTCCAACGTACGATCAGGTTTTTAGTGGCATCAAAGAA
GGATTG