Description :
From Genome Similarity Track
Location :
Scaffold_164:16189- 17631
Sequence
1442 bases(100 bases per row)
GCCCACGGCGATGTCGAAGGTCGAATAGTCTTAGTCGACAACAGGACTTTTATCAGATCAGCCAAATTCTCACGAAATTTTGGCACAACCGGTCGCAAGC
GCTGCGCGATCGGCCTTGCCTCTCCAACATCAATATCACAAAACGGCCCACGTGCTACAGGGGGGAATGCATTTCCTTTTACAATCAACAGGTGACGACG
CTTTCATATCAGTTGTCGTAAATTCTGTTGATCTTCTGAAAAGGGTACACCAGGATCGCCAACCTGGACATTGTCGATCGTTATCTCTGTCGTAGATGTC
CAACCTCCGGTCGCACAGCCATATGCTGTTACACATCTTCAGCAAACAGTTCACCTCCTTCGTGGTAATAATAAAATTCGGCCGGTATATCTTCTTTCAG
CATTTCCTCGTCAATAGCATCAGCCTTCGCGCTGTCGACCAATCGTGTGGACTGGACATGTACTTCCAGATCCTCGACCTTGATCTCATCTGGATGACAG
TTGGACTGCCCTTGTAGCGGATCAGTTGTCACATGGTCGACCTCCTGTGTTATGTCCCTCTTTGCAACTTCTTCTACTTCACTCGATCGTTATGGGTTCT
TCCGCACTAAGTTGACCGTGCACGATCTCTTTGTCGATCTACCATCCTTGCCTTCGTTAATCTTCCCACCCGTATACTCGTCTTGAATCTTTATCATTTT
TGTTACAGTCAGGTTTAGATCGCGATGTGATCCCTGCAGAAACCTTGACGTCTTCTGATTCCTCCTATGGTCGAGTTAAAATTCGGGTGGGTTTCTCGTA
CGTAGGATGATCTACTAGCGGTCTCGCATATGCTTCAATCTCTTCTTCTTCTCAATCTGTAGTAGCTTCAAAGTCCAATGTTTGCCATTCCTTATACCAC
CGCGATCCGACAGGTAGATATCCCTGAGACCGCGGTGTCATGTCTTCTGTCATCCACAACGCTAAAGGGGACCCGTAATTTAAGATCAAGTCGCTATCGC
TTATATTCATAATCTGCAAGAACTTAACCATTTCGGGCCCATTCGTCACGGTAAGAACCCACGCCACACCTCGTATCACCCAAACCTTGGACTTGGGAGG
ATTGACGCCAAACCTGACTTTAGTCGTTCTACCGGCAGGGATGACAATGTGTTGATCGTTGAGGTTGATCGCCGATACCTTGGATCGATGTGGCGGTCTC
AGCCCAGCCAAACAGATGCGAACTTCGGCTGGTAGACACAGGGTCCGTCGGCCAAATCCAACGGATGCCTGTCGGAACCATGAAGTCGATACGTAGTATA
GCTTCTTGACCAACTTGACCACCAACCCAGTCATCAAAATAGTATACTTGTGATCCGTCCAGTGTGATTTTGATCTTGGTCCGCCCCACCGTCATACAGG
CACTCTCCCCGATCCCAACACATTCTTGCGTTCGGCTCTCGT