Description :
From Genome Similarity Track
Location :
Scaffold_164:16186- 17614
Sequence
1428 bases(100 bases per row)
GGCGCCCACGGCGATGTCGAAGGTCGAATAGTCTTAGTCGACAACAGGACTTTTATCAGATCAGCCAAATTCTCACGAAATTTTGGCACAACCGGTCGCA
AGCGCTGCGCGATCGGCCTTGCCTCTCCAACATCAATATCACAAAACGGCCCACGTGCTACAGGGGGGAATGCATTTCCTTTTACAATCAACAGGTGACG
ACGCTTTCATATCAGTTGTCGTAAATTCTGTTGATCTTCTGAAAAGGGTACACCAGGATCGCCAACCTGGACATTGTCGATCGTTATCTCTGTCGTAGAT
GTCCAACCTCCGGTCGCACAGCCATATGCTGTTACACATCTTCAGCAAACAGTTCACCTCCTTCGTGGTAATAATAAAATTCGGCCGGTATATCTTCTTT
CAGCATTTCCTCGTCAATAGCATCAGCCTTCGCGCTGTCGACCAATCGTGTGGACTGGACATGTACTTCCAGATCCTCGACCTTGATCTCATCTGGATGA
CAGTTGGACTGCCCTTGTAGCGGATCAGTTGTCACATGGTCGACCTCCTGTGTTATGTCCCTCTTTGCAACTTCTTCTACTTCACTCGATCGTTATGGGT
TCTTCCGCACTAAGTTGACCGTGCACGATCTCTTTGTCGATCTACCATCCTTGCCTTCGTTAATCTTCCCACCCGTATACTCGTCTTGAATCTTTATCAT
TTTTGTTACAGTCAGGTTTAGATCGCGATGTGATCCCTGCAGAAACCTTGACGTCTTCTGATTCCTCCTATGGTCGAGTTAAAATTCGGGTGGGTTTCTC
GTACGTAGGATGATCTACTAGCGGTCTCGCATATGCTTCAATCTCTTCTTCTTCTCAATCTGTAGTAGCTTCAAAGTCCAATGTTTGCCATTCCTTATAC
CACCGCGATCCGACAGGTAGATATCCCTGAGACCGCGGTGTCATGTCTTCTGTCATCCACAACGCTAAAGGGGACCCGTAATTTAAGATCAAGTCGCTAT
CGCTTATATTCATAATCTGCAAGAACTTAACCATTTCGGGCCCATTCGTCACGGTAAGAACCCACGCCACACCTCGTATCACCCAAACCTTGGACTTGGG
AGGATTGACGCCAAACCTGACTTTAGTCGTTCTACCGGCAGGGATGACAATGTGTTGATCGTTGAGGTTGATCGCCGATACCTTGGATCGATGTGGCGGT
CTCAGCCCAGCCAAACAGATGCGAACTTCGGCTGGTAGACACAGGGTCCGTCGGCCAAATCCAACGGATGCCTGTCGGAACCATGAAGTCGATACGTAGT
ATAGCTTCTTGACCAACTTGACCACCAACCCAGTCATCAAAATAGTATACTTGTGATCCGTCCAGTGTGATTTTGATCTTGGTCCGCCCCACCGTCATAC
AGGCACTCTCCCCGATCCCAACACATTC