Description :
From Genome Similarity Track
Location :
contig_5:161757- 164600
Transcript NameFunction/comments
g1317.t1hypothetical protein PHYSODRAFT_466812
g1318.t1hypothetical protein AM587_10008497

Sequence
2843 bases(100 bases per row)
AACAAGATGATCACCGCGTCCGTGGGCGTGGACTCGAGTCTGCTGCTGGAGCCTGCGCGCGAGCTACAGTTCCCGCTGCCGGACGTCACGTCGGGGCACC
GTCCGCGCTGCTGCCTCACGCTCACCAACTTGTCGCCGCTCAACGACGTGTTGTTCCGCGTACGGACCCGCAACCCGGACGCGTTCACGGTGTGTCCGAC
CCACGGGCAGCTAGCGCCAGGCACGAGCTCCAAGTGGTCATGACTGCAACTGCGCGGACCTGCGAGCGTCTGGGTGCGATGGACCCGCGGGATTTGATGA
CCCGTCAGTCTTCCGAGCTCTTCGTCGTGCAGAGTATGGAGCGAGAGAAAGAGGTGCAAACCATGCAACCGCTGGACCCGGACTCCAGCTCATCGCTGCG
GGCTTTCTGGAAGCAGATGCCGAGAGACTGCGTCACGGAGAACAAGCTGGTGTGTCGGTTCACTGCTGGTATCCCTGCGCTGGCGACCAAAGTCACACAG
GACCCCAATATGTTCTCGCGGAGTTTGAGCAACACGAGTATGAACTCGCAGGAGTACCGGTCCGTCGCGGTGAAAACAGGAGCTTGAATATGAGTGCGCA
CGAGTTCCGGTCGAGTCGCAGTGGAAGCAACAGCGAGTTTAGCAGACTCAATCGGTCTTTGAGCAACCAGTAACGCCCGCCGGAGATGCACAGAAATGAA
CGCTGGAGCCGAAATCAATCGTTTGGTAGTGACGCCAGCTTCCACACCACAATTGAGCCCCCTATTGTGAACCGAAGGTCGGAGGCAAGAATGTCGACTT
CGTCTAACTGGGCTGCGTCTAGAACTCCCACGACGAGGCTACGAGACAGCGCGCTAACTAGCATCAGTGTGAGCGACGGATCTGTCAGTGACACTATGCT
GTCCGCGCAGACTTCCTTTTCCACGGACACGGCAACGGAGGAACAGACGCACGAGCTCGGTCCACTTCAGTACCACATTCAGCCTAGTGACGTGCTTTCG
TTCAATCTCAAGCGTGCACCACGCTTCTGGGGTCAGACTTCGCTCTTCGTGGTGAACTCTAGCCAACACGACTGTCTCGCTTTTAAGGTGCGCACGTCTA
ACCAATCGGGCTACGTGGTGAAGCCCAGCCGAGGGCTTGTATCGACTACGAATGCGCAGGAAGTGATCGTGTCGCTGTGTGCACCGCGCGATGAAAACAG
TTTTGATCCCGCTAAGCGCGAGGCAAAAGATGGCTTTATGATTGAAGTCGCCAACATCTCGCGGGACAAGTACGAAGGTTTGATGAGACTGGACGAGCGA
AAACGCACCCGCGAAATGAGCTCTCTGTGGTCCCTTATGCCTCGAAGTGATCGTCGGTCGACAATGCTTTCTGTGGAGCTGAAGACTGGAGGAAGCGATT
GCGGTAGTGGCACCTGCGACAGCTCTGACAGTGGAAACTCGGACGCTCGGAGCACTGTCAACCGGAGTTCACCTGAAAAGTCTCGACAAAGTTTGCACTC
GGTCGTGCGGGGCATGAAACAACTATCTACCTCCTCTTCAACGGATGAGTCGCCTGAGAGCGTCGCAGAGGAGAAGCCGGGATCCGCGTACGATTCGGAC
GAGTCGGCGTTCACTGTCGCTCCGAGTGTCGCGCTCTCTGAGGTTGGCAAGGATGAATCTGGCAGTGATGCGGACGTGGCCTTCAGCTCGGCAGCAAAAA
GCCTGCCACGAGATCCCGCTGTGATTGTCGTCTCAGCCGACAGGATGGACACCGTCGACTTTTCCAACCCGAAGCTGTCCTTCTTTATTTAGTTGTTACG
CCGATGGGGAGCCGCGTCGAGTGTTGAAGGCTTGAAGCCTTAAGTCTATGCTTTCATGACGTCGTAACTTCATCCCAAGGACTAGGCTATCAAAAATGTA
GATTCGTGAAGTTTCAAAGGTTGTTTCTGCTTATTTGTAGAAAAGGTCGGTTATGCGAGTCCATTGACGGTGGCTCAGCCCCGTGTGATCTAGCTACTCT
CTACTTGGTCACGATGTTCTCCAGGCTCTCGAGAACCTTGACAGTCGAAGACGTACCCAGCATGTTGATGATGCTAGGTGGGATGTAGCCGGCCAGGTCG
GCGTGTGCGAGGAGGGTCACGATGCAGTACACCTTGCCGTCCTCCTCCTTGAACTCCTCAATGAGATAGCCCGATATGTAGTTGTGGGCGCGCACGTAGC
CTTCCAGAGGCGCGACGTCCGCGACGTTGACAGAGCGCGTGGCAATGGCGACTCGTCCGTCTTCGAGTGTCGTGGCGTACGTGACCACGACGAACTCGCG
GCCGTAGATTGGGAACTGACCCTTGCTAGTGATCTGGCGGAAGGCCAAGTGGTTGGACTCGCCGATGTCGCGCAGCGTCACGATGCCCTCCATCATCTCG
TCCAGCTCCAGCGTGCGGTTCGGGTCCAGCAGCACCTGCTCGATGACGCGCTTGTCGGCATCGATGCGGCGCGCGGCGCGGAACGGGCACCAGTCGCAGT
CCTCGACGGCTCCGCGCCAGATCTGCACGCCCTCGGCGTCGTCCACGAGCTCCCACGTCGTGACCTTGTCGTCACCTGAGTGGCGGTCGAGCAGAATCTG
GATGTTCTCCTTGCCGTAGGCCTCAAAGTCCACATCGTCGGCTGTGGGGTACGCGGGCTCCTCAGGCTTGATCTGCTCCTCCGCCGCCGGCGTTTCTCCG
TACCCGAACAGGTAGTTCATACTAACTTGGTGCAAATGAAGAGGAAGGTGGCGCTGAAGAGGGGGTTTCTCGACTGACTCCGCCCACGATGGGAGCCGCT
TGACTGCTTTGACTGTTTCTGTTGCGGGGTACAGAGCGAAGCG