Description :
From Genome Similarity Track
Location :
Scaffold_68:1617- 3860
Sequence
2243 bases(100 bases per row)
TCTTCATCGGATCCAGTTGAGTCCAATTCCGATCCGCTGCTTTCGACTTTCTCGCGGATCGCTCGCGCTGTTTTCGACGACATCGGATTCGAAGAGGTGG
TCGTTCGCTGATGAAATTTGTCCGATCCCATCGGCGCTTTCATCTGGCGATTCTCCATCCGTTGGCACGCACGTAGAGTTTTCTCCACCTCTTCAACATC
CATCAATCGCAGTAAAGTCAGCTGTTTTGCCAGATCACGACCGTCCAGCGTAGCAATGAAGTACTCCGCATTTTCGCGACGTGTGGCCGAGGTGGCCAAT
CTATCTTCTTTGATCGCGATCTTGGCGTGCTTTTCTGCAACATTAAGGCGATGCAAGTTCTCCAGCGGGGTTTCATCTGATCTCTTCCGTGCGATATAAA
TATTGCCTAGCCACAGACACCCCTTGCCCTCCATACTGAATCATGAAACAATCCAGCAATCGCTTCCACTTGTGCCGAGTAGATCGACTCAGTTGGTTGT
TCCAGTTTCGTGCTGGCCCTATCAACAGATCGACGAACCACAAACACTTTTCTTCGTCCGGAGCCTGATCGCGCAAGAATGTTGACTTGACCTTGCTGAT
CCAGGTTCTGGCCTTATCTTCATCTCTGTCTTTTCCAATGAATTCTTTCAGCTCCGTCATTGCTGACACACGAATACGTTGAGGAATTCCACCACCATTC
AGCAACTTTTCTGCGGTGGCCACCATCTCACGTCTCCGCTGCTCTTCTTGACCCGAATCATCGGGATCGACGTCTTCCGAGTCGAAAATATCCGATCGAC
TGCAATGCTATCGGACCGATTCCATCTCGACATCTGGGGTGTATACTTCTTGAACTCTTGTAGCCTTAATTCTTTGGCTAGGATAGATTGCTTGATACGC
TTTCTTCCTTTGTTCTTGTTGAAAACGTTCCATAGTCTCTTCGAGGTACGCCTGCAGGTGTCCTTGCATAGTCAGATTCGTTGTTCCTTTAGCACGTGCG
GTAGTCGATCGTGGTTCAGTCTTGATCGTTTCAACCCGATCGCACAGATGCGCTGCCCCACTTGAGCCTAGACACATCTGCTGAATACCGATCGAATCAT
CCGACTCGATTTTCGATTCAGCTGACGCGTACTGCGACGATCCGGTGTGGTATTCTCTCGGGGTGTCTCCGATCGCTGCTTCCGCTTGATCCGTAGGATC
ACACTTACCCGTTAGGGGAGTTAACTTGTCGTATAGCGATCGATACGCGTAGATCACCTGATCTTAATCACACTCCAATATTTCGTTCGCGTCGAACACC
CCTGCGACAAAACCGGCATCATATAGCAGCCGTATGATCCCGTTGATCTCCTCCAGAATAACAGACGCTACTGCCGGTAGGGGTATCGGACCTTGGATTC
CTCCGATCAGCTTGGGCTTCAGAATCCAGAGCACTGGGTCACTTGATAGAGATTATTGAGTTTCTTCCAGTGGTATCCCTCTGCCAACTGATCCAGCTGC
CATCCTTCCATCTTCATATTGTCGTCCACGAACTTGATCGGTCGGTTGACCGATTTCAAACTGCGATCTGATCCGATCTTGTCGCTTCTTTCTACACTTG
TACTGTCTTCACGTTCTTCGTCTTTGACTTTGCTTGAGTGATCTTTAGTGACAACTGTTCGGTTTTATCCGAAGGGTTTTCGCCCAACAGGTCGTGCTTT
GCGACACGATCCTCGGTGGCCCCCGAAGGGACCTCAGGAGGGGGTCGAAGTTTCTCTTCCAGATCGCCCTATCGATGTTCCTCTTTGATTTTCTTGTCAT
CAGAGTCCCTACCAAAACTTCGATAATCTGGCGATCCTTTGAAATCACGAGTCGGCGGCGATCTCTCTGCCTCTGACGCTTCCAACCCAGGTTCTGTCTT
TATTTTGACCTCTTCACTCCCGGACTCACGCTGAAATACCGAGTCACCAAAAGATCCGGGCACGCGCACCATTGTCGTGGAGTGGCGATCGCTCATTTTA
TGAGGCGATCCCAACTCTTCACTGGTGCGCAAACGACTGAATATCAGAGAGGGTGCTCCGTTTCCGTACCTTGTATTTCCTTCCTCACCTTGTGTACCCG
ACGGTAGGGCGGGCTGCACTCTTCTCGGTGGACTCGTGCCAAGGGAAAACTTAACCGTGTTGGGGATGGGGTTTGTGATCGTGTGGAAATCTTCACACGA
TCACGGGTATACTGGTGGGTTACTTGATGTAAGCCACCCATAT