Description :
From Genome Similarity Track
Location :
Scaffold_1794:1617- 2782
Sequence
1165 bases(100 bases per row)
GATCTGTTTACCGGGTACGTGATAGCCAAAGCTAGTGCGTCTAGAACGGCACAAACCATTGCCGAATCGTACGAGGAGTGCGTTTTCCGAAGATTTGGGG
ATAGTGAGATGATTAGGCATGATCGGGAGCCAGGCTTTATGTCTGATTTCTTTCGAGCATTCAACCGGATCCTGGGGCAGCGACAGCGAGCAACCATGGC
ATATCGTCCCCAAGCTAACGGGTCGGCCGAACGCATGGTACAGATGATCACGAGGGCACTCAAGATGTATGTCCAGGATTTGGATCAGAGGGATTGGGAT
GAGTACGCAGAACGGCTCTACTTCGCGATGAACACCGCCCAAGACAGGATCCGGGGTGATACCCCCATTTTACTTGGTACATGAGTGGGATCCCAAATCC
ACCCTGGAAGCGGCCATCCCAGTATGCAGCACCAAGAAGAGAAACCGAGATCCAAGGCGATGGCGATACCAAGTCCAGAAATACTACCGGCAAGCCAGAT
CCCAAGTGAAAGAACGGCTGCGGAGTGCGATACAAGATCGAGCGGATCGACACAACGAAGACGCCCGTCTACATCAAATCCAAGTGGGATCGCAGGTGTG
GCTTTATTTGGATCGAGTGAAAGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCACGGACCGTTCCGGGTGAGCTAAAAGATAGGGGAACATGCGGTG
AAGTTAGAAACGGCAGGTACCGAATATCGCTTGTTCTCTGTAGTACACGTATTCAAGCTGAAGTTGGTCAAGGAATATCCGGACCGGCCGTAAACCCGTC
TTTCGGTGGATGAATCCGACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGCCGACGAGTTCGAAGTCGAGAA
GATCACCGATATGAGGTCGGGGAAACGAACTAGATACGGACGGATTTACCGCGAATTTCTGGTGTACTGGCGTGGATATGACGAACCCAGTTGGGTAGAC
GAGGCAGATCTGAACTGTGGAGCATTACTCTACGATTTCTTGAGGGATCGTACGAATCGTAACAGATTCGGCGTGATGCAGTCTCATGAAGAAGAGTAGG
GAGGGGACCCATGGATGTGAGTTGGTCATGTCGATGGGAGAATGAAAAAGGGCCCTGTGGTGAAG