Description :
From Genome Similarity Track
Location :
Scaffold_51:16169- 19898
Transcript NameFunction/comments
Hyaar_Emoy2806471hypothetical protein

Sequence
3729 bases(100 bases per row)
AGACCGAGATCCACTTTTTCAATGCCGAGTGTGCGCTCTCTATCCTTGACGTGGTGGTATGGCCAAAGTGTAGCTTACCTCGCAGAAAGCAAGCTACAAA
CCTTTCCTTATAGACAAGCCATGTTGTCTCAAGATAGGCCATGACATGAAGTGGGAGCATTTCTTGCATAGCCTCAAGCTGCTGTTCATAACGTGCCACT
GTGTTTGAAAACACAAGAGCGTTCCACTGCTTGAGTATCTCCTGAAAGGCCTCCATTGAGTCAAATGACAGTCGATGCTTGGCAGTTATGTTCTTATCGA
TATGCCAGCGGCAGAGGAGGAAGTCAGCATCAGGAAACACGTTGTCAAGCGAGTTCATCAAGGCCAACTCCGGGTCAGTGACAAAAGTGGATGGAATGAC
TCCAACCTGCTCCAAAACGCGCGCCACAAGCTGCACTGCCCACAGGTAATCCTCTTCTGTCTCGGCTGCCATGAAGCAGTATGCAAACGTGAACGTCTGC
GATGTGGCGGTCACGCCTACAACGTGCATCAATGGGAGCCCAAAACGGTTAGTCTTGTAAGTTGAGTCAATCAACCATATTTTTCCCGCTGAAAACTTGC
TGCAGACTTCCTTTGCTGATGGCGAGACAATAAACAGGTGCGTGAGCCTTTGTTGGTCATCAAACTGCGTGAAATAAGGGGCCTCGGCCTCGTTCCCCTC
AAGTTTGTCAAGCAGCGCTTGGAGCGGAGAGCGGCCAGCCAAATTGCGGTTGCGCTCTGCTTGAATTAAGTTGTACACATCACGAGGGGTCACACTCACA
GTTTGCCTGCGCATTGTACTGACTATGCGCGTTGGTCGCAGCCCATCTGAACCAAGCCGAATAACCTCTTGGCGTTGGGCCGGGGTTATAGCGCGTCCTT
GCGGGTGGACAGACTTGTCTGCAAAGAGTGCATGGTTGTATTCCTTGTCATAAAAAAACACCGCCCACTATGTGCCATTTTGATGGCGTATGGTGCAGTT
AAAGGTACATCCTGTTCCCCGGCTGCCACGCACGCGTTTGCGTTGTTGCTGTTCTGTTTCTGCCTCTGGCTGTGGCCGTGGCCGTGGCTGTTGTGCTCCA
CAAGAACAGTAGAGAGCCACTGCTTTGATGTCACCATCTTTTTGGTTACCCACCCGCCTTGTATGCTTGATAGTGAAAACAAAGCCCTCATCTTGCAGTT
GGGAGTCTACTGCTGCACGAGCCTCGTCTAGGGTGGAAAACACACGCTCTTCAAGCTCTCCAAGTAGTTCCAAGTTGTTCAGGTTGTTCATTGCAACGAG
ATTAAGGTGTTATGGAAAGTGAATTGACGCTGAAAATTGGCGGCAGCAAATTATTTTTTCGTGATAATATTGAATGGTTCCAGCCAACCACAAGCCTCGA
AAACGAGCCTAGGGGTTCTATCGACAGGGAGGGTGGTGGTTAGCCAAAGGTGAGTGCTGGTTAGCGGCTCCCTATTTTAATATTAAAAGGATTAAGTGGA
TGTCTTGGCATTAATTTAATTTTTAGGACGTAAAAAATACAAAACGTTTTGTCAAATAATACTTTATTTTAGAATGAAAATTCCGTTAAGAAAACATTTG
TTTGTAAATTTTTTAAGGACAATGAATCGAAATATTTAAGTAACTGCTAAAAAATCAAACGAGATTCCGTTAGTTATAATGAATGAAAATGGAAATTAGG
TTTTTGATAATAAGAAATAATTTTTTAATTTTTTAAAATAAATTCTTAAAGGTGAAAGTATTGTAGAATAATTCCTATTTTGATAATAGTAAAAAGAGGT
AAGCGTAATCTTTTTTTATATTGGGGAGCCACCCTCAAAATCTTTTAATAATTAATGAATTAAATATAGGTATTTTATATTTATTGGCAATTTCCTCAAT
AGGAGTATATGGAATTTATTCAAAGATGAGATAGAGTAACAAGTTAACTTATCAGGCTCATTATCTGAAGATGTAGGTTCAAATCCTACTCTCATCATAG
TTTCTTAAAATGTAAGAATAATTTATGATTCAAATTCAAACTTAATTAAGAATAAACGATAATAGTGGTATTAAAATAGGACAATATAAATAAAAAAAGT
TTATTTAAAAAAAGCTGGAAAATTGGAGATACTGATGTCGTTAAATTTGTCTTTACCTTGCAGTTAGTACACTGCCGCTCTTCTTAAGTGATGTAACGCT
TGAGCAGCATATTCATTTGGCTTTTTATTTTCTTCGCAAGATACACCGTGATAAACCTCGAAAACGCGTCTATAATAACTAGTACTGCATAAAATATCAT
GCAGTTGTAGTTTTTGAAATGGTAATAATAAATTTGCAAAGACTAGTTGATTGTGTTCAGTATTACCACCACCAAGCATATATTGCGCGGGCTTTCCACG
TTGTTTCTCCAATTGACATGCTTCGCATGTATCAAACTGTCGCTTTTGAAGCATCAGGCCGTCTACCAAGTTCTGATCGACCATCTTTCTCACATGCTGA
TGGCATAATTCCCCCACCTTGTCCATGCCAGCTCCGCAAGTCTGCAACACCATCAAGCAGTGCGTAATTCACCATTGTGGTTGGATCGTGCGCCTTCTGA
AGCCTATGCAAGAAGTTGTAATAAGCCGTGAACATCCAATGCCGACACGATCTTAGTGGCGCTTGTAGAGCAACAGCTTCATTTTCGCTCAACGTGTACG
CCCTTTTTTGCGACATTATACTGTACTTTGAAACCCTGCTTCCGTGCTACCGACTGGGAGAAAGTGTTTGGATGTTCAGGTGAATAGTAGAAATCTCCGA
GTTTAAGCGCGACTTGATCCTCCCTCAAGAACTAGTAGTAAGTTGATCGTACCGACTCCAACAGGTGCAGTGGGATCATAATATCCATTCACCGTCTTCT
CCTTGCATTCGGTATAGGTCAGGTTCCAAAAATCTACAAAGTACCGTTTAAGTCCGACCAAGTGTCGGTTCGCACTAGTATCGTATACCCAACTTTCGGG
CTGGTATCCATCCTGCTATTCTGCTTAAAGTGGAGTACGGGCGCATAACAAATCATCCCAATAGCACCGTGAGCTTCTTTTGGTTTGTTTCCCGCACTCG
CTCCAGCTCATTTCACCTGTCTATATTGTTTTATAGCGTCCCTAGAATTTGAGGTTGTGACTGTTGTTATAAAGCTGCGTCAGTCCGCTTCGCGTATGAC
AAATTCGCTCGGCCTGAGCTTCTAGCAGATTTATTTGGCCATTCATTTTGCGCATGCTCGGGCATGTGATAGCAAAATAAATTCTGTAATCACCAGTCCT
CATCGTATTGGCCTTGAGTTTACTTCCGGTTATCCCCATAAGTTTTGCTAAAGCCGAAGTTAACGCCGCCACTATTTGACTTGCTTGGAGATCTTATGCG
TGTTGTCCGATCTGAGCTTCCGAAGGCTCGTGACAACATCTGGTCAGCCTTATTAGCCCTGTCGTAAGTTATTGATATCTCAACGATCTTTTCGGGAGTT
TAAACACGATCAAGTCCAGGCTCTACTTTTCTACGCAATCGGTCGAATCGTTCTCCCTTAGGAAGAGATGACACTAGAATCCCACTAAAAACTGTGCCAT
CTAGTGCCATACCAATCGTTTGCATCCGTGTGCGCAGTCAAATCGTATTGCTCAAATGTTCTTCAATATGGCTGGTATGCCTGCATCGTGCAGTCTTTAG
TTCTGCGTACGAGCGTCGCTTAGTCAGAG