Description :
From Genome Similarity Track
Location :
Scaffold_202:16168- 17580
Transcript NameFunction/comments
g10309.t1hypothetical protein

Sequence
1412 bases(100 bases per row)
TCGACTTACTCTTTGTTTTTGACCTGTGTACTCTCTCGGGGCGATGACTCCAGGTTGCCTATAACGCCACCAATGTATTAACTACTGTAGTACATTAGTT
ACTGCATACATTAACAAACAGTTTACAAGGCCCGCTATAAGTAGCAGCGATACAATTAGTGTTCTCACGGAAGTCCAGTCGAGGACACAAAGTAAACGTA
AGCGCTGGAAAGATAATACCCCCGAGTAAAACAACACATCACCCATTAAAAGTGGCAAAATTCAATCGAGAAATCAATTGAGATCGCTAGGCTCGAGTTA
GGTAGGTCGTCTATCTAACGAGCAATCGCAGTCAGGTACTTCGAGTATGCACTAACCATCAACACTTGCTGGTCATCCGTCAGAGAGGACCTTTGAACCA
TCGTGTAAAAGTCGTCCAGGCCCATGCCCGCGCGGTAGGAAGGGAACACATTTTTCAGCTGGCTCTCGGCTTTAGTAAAGAGAGCTATCAGTACGCCGGA
CTCTCGAACTGAAGAGATGATCCGAGCCATGTCATCGGTCGTTTGCGCCAGGCCAAGCTGCGCCATCACCTTAAGAGCCTTTGCCGAGTCCATGAACCCT
CTCTCTTCTTCGTCGTCGTTCGTCTCTTCGTCATTTTCGTCATTTTCGTCGTCTTCGTCATCTTGAACAACCTCGTGCTTCCTCAGGAATCGGCGGCCGT
TTCCGATGCTCTCAGTCGGACCCACTGCATTTGCCGTACTCAACTGGGAAAGTGTGGTCCCGCTGGCCGTCGACGTAGCGTCGAGCGTCGAGACGAGAGC
GGCTGCCGCCACGAGAAGAACGCAGCTCAGACGCATGGATCTCTTGGGTTAATGGTGTGGAGAGGAGAAGTTGGACGCTTGTGCCTTGGGATGCAAATTG
CGAAGTAAGAGTGAAAAGCAAGCACACAGTTCCACATGTACAGTATTGTAGCACTTCTTTTGGTGGTTATCGTCATCAGTCCCCGGCATTGCTCTACTGG
GGACTGATGACGATAGCCACCAAAAAAGCAAGCATGGATGAATCCGAAGCGCTATCGTACTAAGCTACGTACTACTCCGATCCACAACAGCTGTCAGGAA
ACCGCATACATTGGTCTATATTCGTCAATATGTGCATTAGAAGGCTCTGATTGGGCTAAAACGAAACTCGTGAGCAAGGCGATCCGAATGCTGTGCGCTT
TGCCGTCGATGAATGGTCGACAGCCTATCGAGCTCCAAAACTGGGAACACACTTCAGATGTCGCCCATCCTTTTGAATGTCTGTGACGTGGGGGTGTTCA
ATGCAATTTAAGCACGGCAGATAAAGAAGACAACCAGAACGCTGGACGAGCTGGTGATGGTGGTTACAGAAGCGTTTTGGGAGCTGCCAAGCTCAACGCT
ACACAACACATT