Description :
From Genome Similarity Track
Location :
Scaffold_79:161613- 162740
Transcript NameFunction/comments
Phypa_INRA-310PPTG_18058hypothetical protein

Sequence
1127 bases(100 bases per row)
CCGTCGTCCAAGGTGAATTTCCTCCTCTCCCGACTATCCGGACAAGCCAAAGAGTGGGCCCTTGGCAAGCTTGTCGTCGAGCTTCAAGCGTTCCCGACTC
TGGAGGCACTCCAGAGTGACCTGCGTCTCGCCTTTGAACCTCCACAGGACGAGTCCCGGGTTCGCGCCGCTTTCTTCGCCCTGAAACAGAGTAAGATGTC
GATGCGAGACTACGTTTAGAAGACATGGCACCTCACTTCGCGTATTATCACGAAGCCGGTTGACATGGCATCACAAGTCCATGTTTTCGTGTTTGGCATG
CGCGAAGGTATGACGCGGTACAATCTCACCCGGGCGGAACCTGATACGCTAGAGAAAGCGTTCGTCCTCGCGCTTCGCGAGGATTATGTGGTGACGTCGT
CGTACGCCCGGTTTCTGTCGACGAAGGAACTGGAGAGTACTCCGGAGCCCATGGAGATTGACGCTATCGAGGCCTCAACCAATCGTAAGGCTCCTGATTC
CCCCGCGAACCGTGGAGGTAGGACGTTGCGTCCATTGACTTGCTTCCGCTGCCGGAAGTTGAGTCATCGCGCGGCGGTCTGTCGCGCGCCAGCTCCTGCC
ACCGCGAACGCCGTTGTCGACGAGGTCGACACCCCTATCCAGGCCGGTCAGCCAAAAAAAAAAAAAAAACGGCCTGGGCCAGTAGGTACGGGACGCCCTA
CTGGCTGGAACGGAGGTCCGGGCCCACTGGTGGCACTCGAACCTTCTAGCCCTCCCGTGCTACATACACGTTGCAATGCCACCACTGCAGAGGCGACACG
AGGCTGATCATTGTTAGTCTCCATGTCGCCGGCGCCCGACGTCCACTACGCGCACTCCTCGATTCCGGAGCGACGAACAACTTCTTTCGCGTGTCGTGCT
TGTCGGTGTTGCCAACGGAGACCCCCGTCCGTGAAGGACAGAGCGAGGTTGTGTCGAAACTCGCGGACGGGAAGGCTCACCACGTCAAGCGGTGTGAGAT
ATCACTCCCATACACGTTCGATGGCTTCACCAGCACGGATGATTTCCTGGTGATCGAGATGAATTACGCGTTCGACTGCATTCTTGGAATGCCGTGGCTG
ACACGGTACCAGCCTGAAATCGACTGG