Description :
From Genome Similarity Track
Location :
scaffold_5:161531- 164376
Transcript NameFunction/comments
g8125.t1hypothetical protein
g8126.t1 conserved hypothetical protein

Sequence
2845 bases(100 bases per row)
AACAAGATGATCACCGCGTCCGTGGGCGTGGACTCGAGTCTGCTGCTGGAGCCTGCGCGCGAGCTACAGTTCCCGCTGCCGGACGTCACGTCGGGGCACC
GTCCGCGCTGCTGCCTCACGCTCACCAACTTGTCGCCGCTCAACGACGTGTTGTTCCGCGTACGGACCCGCAACCCGGACGCGTTCACGGTGTGTCCGAC
CCACGGGCTGCTAGCGCCAGGCACGAGCTCCCAAGTGGTCATGACTGCAACTGCGCGGACCTGCGAGCGTCTGGGTGCGATGGACCCGCGGGATTTGATG
ACCCGTCAGTCTTCCGAGCTCTTCGTCGTGCAGAGTATGGAGCGAGAGAAAGAGGTGCAAACCATGCAACCGCTGGACCCGGACTCCAGCTCATCGCTGC
GGGCTTTCTGGAAGCAGATGCCGAGAGACTGCGTCACGGAGAACAAGCTGGTGTGTCGGTTCACTGCTGGTATCCCTGCGCTGGCGACCAAAGTCACACA
GGACCCCAATATGTTCTCGCGGAGTTTGAGCAACACGAGTATGAACTCGCAGGAGTACCGGTCCGGTCGCGGTGAAAACAGGAGCTTGAGTATGAGTGCG
CACGAGTTCCGGTCGAGTCGCAGTGGAAGCAACAGCGAGTTTAGCAGACTCAATCGGTCTTTGAGCAACCAGCTAACGCCGCCGCCGGAGATGCACAGAA
ATGAACGCTGGAGCCGAAATCAATCGTTTGGTAGTGACGCCAGCTTCCACACCACAATTGAGCCCCCTATTGTGAACCGAAGGTCGGAGGCAAGAATGTC
GACTTCGTCTAACTGGGCTGCGTCTAGAACTCCCACGACGAGGCTACGAGACAGCGCGCTAACTAGCATCAGTGTGAGCGACGGATCTGTCAGTGACACT
ATGCTGTCCGCGCAGACTTCCTTTTCCACGGACGCGGCAACGGAGGAACAGACGCACGAGCTCGGTCCACTTCAGTACCACATTCAGCCTAGTGACGTGC
TTTCGTTCAATCTCAAGCGTGCACCACGCTTCTGGGGTCAGACTTCGCTCTTCGTGGTGAACTCTAGCCAACACGACTGTCTCGCTTTTAAGGTGCGCAC
GTCTAACCAATCGGGCTACGTGGTGAAGCCCAGCCGAGGGCTTGTATCGACTACGAATGCGCAGGAAGTGATCGTGTCGCTGTGTGCACCGCGCGATGAA
AACAGTTTTGATCCCGCTAAGCGCGAGGCAAAAGATGGCTTTATGATTGAAGTCGCCAACATCTCGCGGGACAAGTACGAAGGTTTGATGAGACTGGACG
AGCGAAAACGCACCCGCGAAATGAGCTCTCTGTGGTCCCTTATGCCTCGAAGTGATCGTCGGTCGACAATGCTTTCTGTGGAGCTGAAGACTGGAGGAAG
CGATTGCGGTAGTGGCACCTGCGACAGCTCTGACAGTGGAAACTCGGACGCTCGGAGCACTGTCAACCGGAGTTCACCTGAAAAGTCTCGACAAAGTTTG
CACTCGGTCGTGCGGGGCATGAAACAACTATCTACCTCCTCTTCAACGGATGAGTCGCCTGAGAGCGTCGCAGAGGAGAAGCCGGGATCCGCGTACGATT
CGGACGAGTCGGCGTTCACTGTCGCTCCGAGTGTCGCGCTCTCTGAGGTTGGCAAGGATGAATCTGGCAGTGATGCGGACGTGGCCTTCAGCTCGGCAGC
AAAAAGCCTGCCACGAGATCCCGCTGTGATTGTCGTCTCAGCCGACAGGATGGACACCGTCGACTTTTCCAACCCGAAGCTGTCCTTCTTTATTTAGTTG
TTACGCCGATGGGGGGAGCCGCGTCGAGTGTTGAAGGCTTGAAGCCTTAAGTCTTTGCTTTCATGACCACTTCATCCCAAGGACTAGGCTATCAAAAATG
TAGATTCGTGAAGTTTCAAAGGTTGTTTCTGCTTATTTGTAGAAAAGGTCGGTTATGCGAGTCCATTGACGGTGGCTCAGCCCCGTGTGATCTAGCTACT
CTCTACTTGGTCACGATGTTCTCCAGGCTCTCGAGAACCTTGACAGTCGAAGACGTACCCAGCATGTTGATGATGCTAGGTGGGATGTAGCCGGCCAGGT
CGGCGTGTGCGAGGAGGGTCACGATGCAGTACACCTTGCCGTCCTCCTCCTTGAACTCCTCAATGAGATAGCCCGATATGTAGTTGTGGGCGCGCACGTA
GCCTTCCAGAGGCGCGACGTCCGCGACGTTGACAGAGCGCGTGGCAATGGCGACTCGTCCGTCTTCGAGTGTCGTGGCGTACGTGACCACGACGAACTCG
CGGCCGTAGATTGGGAACTGACCCTTGCTAGTGATCTGGCGGAAGGCCAAGTGGTTGGACTCGCCGATGTCGCGCAGCGTCACGATGCCCTCCATCATCT
CGTCCAGCTCCAGCGTGCGGTTCGGGTCCAGCAGCACCTGCTCGATGACGCGCTTGTCGGCATCGATGCGGCGCGCGGCGCGGAACGGGCACCAGTCGCA
GTCCTCGACGGCTCCGCGCCAGATCTGCACGCCCTCGGCGTCGTCCACGAGCTCCCACGTCGTGACCTTGTCGTCACCTGAGTGGCGGTCGAGCAGAATC
TGGATGTTCTCCTTGCCGTAGGCCTCAAAGTCCACATCGTCGGCTGTGGGGTACGCGGGCTCCTCAGGCTTGATCTGCTCCTCCGCCGCCGGCGTTTCTC
CGTACCCGAACAGGTAGTTCATACTAACTTGGTGCAAATGAAGAGGAAGGTGGCGCTGAAGAGGGGGTTTCTCGACTGACTCCGCCCACGATGGGAGCCG
CTTGACTGCTTTGACTGTTTCTGTTGCGGGGTACAGAGCGAAGCG