Description :
From Genome Similarity Track
Location :
Scaffold_9:16153- 22795
Transcript NameFunction/comments
Phypl_g398hypothetical protein

Sequence
6642 bases(100 bases per row)
CTCGCACGCGTTCGTGGGGGACTTTGGCATGAACATGAACAGCGGCGACAACCGCTTCATGAACCAGTTCAActtgggcggcggcgccaacgtcagcagc
ggcgccatgGGCGGCATGGATCTGTCCGGCGGTCTGgacttcagcagcggcatgaaCCTCATGACGGACTCGTCCATGATGCTcggcaccagctcctccg
cgTCCCCGGCGGGGCTCATCGACTTTCCCGACGAGCTCAACTCgcccacgacgtcgagcagcagcaccagcaatgGGATGAACACGTCTTCCTCCATGAT
GaccgcgtcctcggcgcCGATGACCTCGACGGCCGACGCGATCCCGTTcccggcgtcgctggcgtccgagtcgctgaCGAGCAACGGCACGTCGTCATCC
TCCGGAGGTCTGGACGTGATGAACTTTATGAacacgaccacgaccagcagcgccatgggcagcagcaacaacggGATGGGCCTCGACATGAACGTGGGGG
TGAATATGGGCATGAACATGGGCATGAGCATGGGCATGAATAACATGGGGATGGACATGAGCGGCAACAACTTCGGCATGAACGACGCGAACAACATGAT
GTTCAACAACAACATGCAGCAGATGAACATGATGAACCCGCAGGGAAACTACTACATGCcccagcagcaaatgcagcagcagcagcactacaTGcagatg
atgcagcagcagcgccagctgaaCCTGCtacgccagcagcaacagcagaaagcgctgctcgagcgccagcgaatggcccagcagcagcaccagaacCAGA
AAAGCGGCAGTAAACAACAGAcgcaactgcagcaacaggcagtgcagcagaagcagcagcaaatgcttGCGGCAGGCCAGATTCCGTCTCAAATGGCTGT
GCAGAGGCAGTTGAGCGGGGGCAATCCAAGCGTAAATGCTACGGCTAATCCAAACGCTGCACGGTCGCAACCTCAAACGTCGACTCCAAATGCTGGTACT
GCCACGACTGCGGCGCGACCAACGTGGCAGTCTTCAGCGGACCAGGCGCTGCGTAAGGAAATGCTGAATCACATTATGCGGGTCCTTCAGAACCAGCGGT
CGAATGCCCCAGCAAACtggctgcagaagctgccggaGATGGCGCACCGTCTTGAAGATGAGTGCTACCGGATCGCGGCCTCGCGCGAAGAGTATGCCAA
CACAAGCACACTCCAGTCTCGTTTGCGCAGCATCGTGCGGAGTGCCCAGACTCACCAGCGTAATGTTGGAGCTAATGGGATGCGACAGCCTGGTGCGCCA
AACCAGGCTTCTCCCGCTAATACCAGACCAGCGACTTCCACGCCTGCGGCAACGCCAATCCCTTTCCCTGGTGTACAAGCTGTTGCACCTACGTCGAACG
GGGTGAGCTCGGATGTGAAAAACCTTGCCGCTCAGGCCATTCAAATGCCACCCGAGCTTCAGGATCTGCCGTCTCAAGCGAACACTCCAGTTAAGACAGA
AGTGtcccaagctcaagcgcgcaCGCAGTCGACACTTGTGACGGTTGATTCGATCATGTCGGACCGCTCGTCCATGAGCGGTACAGGCATCTCGCCTCTT
GGTGGACAGAACGGAGTACAAACGACaccaggcgctggtggtgcgaATAACGCGACTGGGTCTGGACCTCAAGCAGCAAactcgccagcttctgctgcac
gcaACAAATCGGCCCAGATCATTTGGCAGTTCAAAGCGAAGGCTCAGCAAGTAACGTCAGCACTGGACAAGAACCAGACAATGGAGTACCACAACAAATT
GCGACTCATGGTCCGTGATGATGTAAAAACCGCTGGATCGAAGGAAGTAttgcagcgacagcagcagcggttgttgctgttgcggCATGCTATGTGGTGC
AAGTCGGCTGAGGGCACGTGCACAACTACTCCGAGCTGTGGCGAGATGAAGCGACTCTGGGCTCATATGGGCGCATGCCGGCAGACAAACGCGTGCTCCT
ACAACCACTGCATTTCGTCCAAGTACGTGCTGTCGCACTTTCAGCAGTGCACAAATCCCAAGTGTCTCGTGTGCCAAGTGGTTCGGTACCCCGTGGAAGT
AAAGGAGAAGAATGGTGCTCTGATGCTGGATGCAGATCGTGCGTTGCAACAGATTATTGCAGCGAGCCAGCGTCGACAACGCATGCTTGCGATGAAaaag
cagcaggagatgcagcagcaacaaatgCAACAACCCATGCCCTTGGCAATGCCCGCGCACTTACAGCAACCGCAGAACAATGGCAATGTCGCGGCAATGA
attttcagcagcaacagcaaaatGTTGAGCAGACTCATGCCACCCCGGTAGGTGCAAACATGAACACCATGGGAATGGTGATGCCGAACGGAGGCAACCG
CCCCGTCCCTATGCCGACAGCGCAACCCAACGCAGCTCCTGTTGTAGCAAATGATATGATGCGTCAGCAAGTGCCTGTGAAGGTGGAAAATACTCTACAG
CCTACAAACCTCGTCCCGGACGATCAACGGCAACTTcagctcatcaagcagaAACTAAGCGGGCGTTCTCTGGAGCAGTTGACAGCGCATTGCGTGAAGT
TGGAGAAGTGGGTGGAAGAGATCCGTGCACGTATGAACGCTATTATGAACGAGTGTCGGCAGCTGTTGCACCTGTCGAACTCGATGCAAGATCCAATGCA
GAAAACTCAGTACGAAGCACAGGTACAGGAGAAACGTGTTATGCTGAAGCAACTGGATGTGAAGTTCAAGCAGTGCAGGAGTCAGCGCAATATTGTGAAG
CATGTGATTGATGAGCGCAATGCGACCGCGGCCATGTCAGCACAAAATGGTATGAATAATACCCCGAGTGCGATGCAGCCGATTCCAATGCCTCCTCAGA
TGCAACAGCAGAGTCCTCTCCAACAACCACAGGGTCCGATTGCTAatgctccagcgacgtcaaCGAAGCCATCGCCCGATGACCTGCTGGGTGAGGAAGA
TGATGTTCCTTCGAAGGCTGATAACAGCCTTGCAGTCGCGGGAAAGCCTCTAGAAATGCCAATGGACCTTCAAGACACAACTGCGACACCTGTTTCAGTA
GCTGCACCGTTGAGCACGCTAACAGCTCCACACCAACCTAGCGGAGCACACTCAATGACAGCAATGAATGgtcctcggccagcgctgcagatgAATCACG
TTCAACGGCATGCGTTTGGCCAAACTCAAGGCCAAATGCTGCAAAATGGGAAGGCGGACAACGCAGGGTCGTCTGGTGTCACGGTTAAAGAAGAATACCA
GGCGAAATATGGTGCTCCTGGAACAACTTCTACCCAATCTTCTGCGTCTGCAGTAAAGGAGGAAGTGGCTATCAACCCGCTGACGATGAACAATTCCAAG
TTGAACGCCATGATGTCGGAGCATCGCCGAATGGATGCCAGCACAAGCTTGCAGCTGCCTGCAGGTGCAGTGGGAACACCGAAGGCAATCATTACGGCTA
GTGGAGGTGATGCGAActcaagcgctgctgcagctgcaacgcCGGCACCGCCTGCGTCCTCGGAAGTTCCGATGTCAGTGCTGAGCGAACTGAGCAACAA
GGACCTAGCTTCTCATGTGGATTCATTAGTGACGTACTACAACGCCACAGTGTCTCCAGCGAACCTGAAGAAGAGGTTGGAAATGATTTTGAAAGGTATG
ATGGAGCATAAATTTGGTTGGGTGTTCAACACACCTGTGGATCCAGTGGCTCTAAATATCCCGAACTACTTCAAGATTATCCGAAAACCGATGGACCTGG
GCACCGTAAAAAAGAAACTTGAAGTAGGTGTGTACCAGCACTTGGAGGAATTTGCTTACGATGTGCGAACGACGTTCCAGAATGCTATGCAGTACAACAG
CGAAGACCAAGACGTCTACAGCCTTGCAAAGGACATGCTGTCGGATTTCAATGGTGAAGTGCGTAAGGTTGCGGCCGAAATTGAAGTCGAAGAAAAGGCT
GCTCGGGCAAAAGAGAGCTCATGCCGGCTTTGCGGTATCGAGCGCATGGTGTTTGAGCCTGCTGTGCTGTACTGCAATGGCGAGTGTAACAGTCGTATCC
GACGGAACTGCTACTATTACACTTCAGCTGATAACAAGTATCACTGCTGCCACCCGTGCTACGGTAATCTGCCTGATACCATCAAGCACAATGAAGGCCG
TCAGTACCTGAAGAACGAGCTCGCGCGAAAAAAAAATGACGAAGTTCACGAGGAACCCTGGGTGCAGTGCGACAAGTGTGAGCGTTGGGTTCACCAGATT
TGCGCTCTTTTCAACGGTAAGATCGACAGCGAGAAAaagccgcagctcgtcaagaCTGAGGGGGGCCAACCGACTGATAGTGGTGATGCGAGTTCATCGC
CTTCATCATCTGGTGCAAAGTCTACCACAGTCACTACAACGGTTGTCAAGagttcgtcgtcatcggGATTGAAGGGGACGGTACATTCTATAACGACGTC
GCCCGGCAGTGAATTTTTATGCCCGGAGTGCTTGCTGGAGCACCGCAACAGTGAGCCGCAGAAGTACAAGATTGGGCGCCACGCTTTCAGTGcgaaggac
ctgcagcgcaCGAAGCTGTCAGATTTTCTGGAGCGTCGTATTGTCAAGTCGTTGCAAGCAGagcgcgaggacgaggcAAAATGGACGCAGCGTGACGTGA
ACGATGTGGAGACCGCGGAAGGTCTCACTGTGCGTTTGGTGTCGAACATTGAAAAGCAGCTGATGGTGCGCGATAAAATGTTCCAGCGGTACAAGGACTC
TCACAAGTACACCTCCGAGCACCGCTTCAAGTCCAAGTGCGTTTGTATGTTCCAGGAGATTGACGGCGTGTCGGTGTTGCTGTTTGGTATGTACGTGCAC
GAgttcgatgaagaagaggcgGATTGCAATTCGCGCCGCGTGTACATATCTTACCTGGACTCGGTGAACTACTTCAAGCCGGCTCACCTTCGTACAAAGG
TGTACCACGAGATGCTGATCGCATACTTCGACTTTGTCAAGCAGCGTGGCTTCCACACGGCGCATCTGTGGGCTTGCCCACCTCTGAAGGGCGACGATTA
CATCCTGTACTGCCATCCAGAAGCTCAAAAGACGCCCAAGTCGGACCGCTTGCGCGCCTGGTACGTGGATATGCTGGTCAAGGCTGAGGAGGAAGGAGTA
GTGTGGCAAATTACGAACATGTACGACGACTACTGGCGCGACGGTAACACGCCATGCGCACTGCCATATTTCGAGGGCGACTACTGGGTCGGCCTAGCAG
AAGACTTAATCGAGAAGTTGGACGCCGAAAAGCCGAAAAAGATTGTTAACAAGCGTGGTTCCAAATCACACAAGCGCAAGAACTCGGATACAAAGAAGGC
AGCGAACAAGAAGTCCAAGTCTAAGAAGCCGAAGCGACGAAAGACCGCGTCCGGCGGAGAGGCGTCaggcgatgaagatgaagacgacgatgcacACGAA
GGCACCACGTCAGCGAGTAATCGCACACTGACGGTGAAGTCGTTGGATACCCCAGACTGGAAACTTTCGGACCCTTTGATGCACAAGCTCGGTGAGGTGA
TCGAGCCCATGAAGGACGACTTTTTggtggtgaagctggtgccATGCTGCCGTGTGTGCAACACGTCAGTGGTGCAAGGCACGCTGTGGCGCGACCACAG
TGTAAAAACGGAACACGGTCTCAACCCGAAGGTGGTTCAAACTGCGCTGTGTGATGGGTGCTACCAGAAACTTAAGGTCGTATCCACTGCAGGATCATCA
GCGGCTCACCACAGGCTCCAGACTCGGCTGAATGCTCTTACCAAAGAAACAGTGGCGTTACCAGAGCGCTGCATGGACCCGGATGAGATCAACGACAGCG
AGTTTTTCGACACGCGCCAGGCGTTTTTGAGTCTGTGCCAGGGCAACCACTACcagttcgacgagctgcggcgcgcaAAGCACTCGTCCATGATGGCTCT
GTATCACTTGGGCAACCCGAACCCGAACGCCTACGTGTACGAGTGCAATGCGTGCACACGTGATATCGTGTCGGGCAACCGCTGGCATTGCCACATGTGC
CCGGACTTCGACGTGTGCGATGCTTGCTacgcgaaggagaagcacgaaCACCCGCTGGAAATGGTGCCGACCAGTggcggaggtgctgccggagctggaA
GTGGTGGCCCTGCTGGATCTGGAGGCGCATCTGGCACTGGTGCGCTCACGCCGGagcagcgtcgccttcgCGAACAGAGAGCCAAGAACGTTCGTTTACa
catgcagctgctggttcatTCGAGTTCGTGCGCTGACGGCAACTGCGGCTCGTCGAACTgcgagaagatgaaggagctgatgCGTCATGGCGCGCAGTGC
AAGCAGCGAGCTTACGGCGGTTGCACGATCTGTCGGCGCGTGTGGGCGCtactgcagctccacgcccgACAGTGTCGCCAATATGAGTGCAAGGTGCCGC
GTTGCCACGACCTGCGCGAACACgtccgcaagctgcagttgcagcaacagctcaTGGACGaccgtcgccgcgctgctgtcaCGCAGCAGTACCGCCAAAT
GCAGaccgagcgccagcaggagcagcagagccaaGCTCAAGG