Description :
From Genome Similarity Track
Location :
Scaffold_837:1615- 3503
Sequence
1888 bases(100 bases per row)
TTCACTCCTTCCTCATAATCCACCCTTCTCCTGTGGATTCGTCTTCTCTTTCTTTCCGATGTGACCAACTCACATCAGCGATCCTCCTCCTCCTTGTCCA
CACCCTTCCTGTGAGTCCTTCTTCATCCTCCCATCAACATGACCAATTCACATCCATGGATCCCCTTCCTACTCTTCTTCATGAGACTGCATCACGCCAA
ATCTGTTCCGATTCGTACGATCCCGCAAGAAATCGTAGAGTAATGTTCCACAGTTCAGATCTGTCTCGTCTACCCAACTGGGTTCGTCATATCCACGCCA
ATCCACCTGAAATTCACGGTAAATCCGTCCGTATCTAGTTCGCTTCCCTGACCTCATATCGGTGATCTTTCGACTTCGACCTCGTCGAGTTCGAGCTCCA
CATTCCAACTATCTTCCGGTAGGAGGACTTCGTCGAAATCCACCCGGTCGGATTCATCCACCGAATAACGGGTTTGCGGCCGGTCCGGGTATTCCTTGAC
CAGCTTCAGCTTGGATACGTGTACTACAGGGAACAAGCGATATTCGGTATCTGCCGTTTCTAGCTTCACCCCATGTTCCCCTATCTTTTCGCTCACCCGG
AACGGTCCGTGCCATAGATGGGCCAATTTGTGGGCGTACTCTTCCTTCACCCGATCTAAATAAAGCCACACCTGCGATCCCACTTGGATTTTATGGGGAT
GGGCGTCTTCGTTCTGTCGATCCGCTCGATCCTGTATCGCACTTCGCAACCGTTCGTTCACTTGGGATCTGGCTTGCCGGTAGTATTTCTGGACTTGGTA
TCGCCATCGCCTTGGATCTCGGTTTCTCTTCTTGGTGCTACATACCGGAATGGCCGCTTCTAGGGTGGATTTAGGATCCCACCCATGTACCAAGTAAAAA
GGGGTATCGCCCCGGATCCTGCCGTGGGCGGTGTTCATTGCGAAGGTGAGTCGTTCTGTGTACTCATCCCAATCCCTCTGATCCAAGTCCTGAACATACA
TCTTCAGCGCCCTCGTGATCGTCTGTACCATGCGTTCGGCCGATCCATTGGCTTGGGGACGATATGCCATAATCGCCCGCTGTCTCTGCCCCAGGATCCG
GTTGAATGCTCGAAAGAAATCCGACATAAAGCCTGGCTCCCGATCATGTCTAATCATCTCACTAGCTCCAAATCTTCGGAAAACGCACTCCTCGTACGAT
TAAGCAATGGTTTGCGCAGTTCTAGACGCACTAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC