Description :
From Genome Similarity Track
Location :
Scaffold_166:161496- 165257
Sequence
3761 bases(100 bases per row)
TCATACACCGGGATATTTGGTACAAGGTACCAGCCAACCATTGGTCAAACGACGTTGCATTTCTATAGGTAGCTTATAGTTTGTATTAAACCCAAACTTA
ACCTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAAATAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGT
TTGTATACTCTCGGAAGATAACTCCCTCTAGCGCAAGGTGCTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGACTA
CCTGAACCTCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAACGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCATCCG
GATGGAGGCCCTGCAGAGCCTGGTGGTGTCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCGTTCGACGCGTACGAGCAGGGCCTCATCGCGCATGTG
CGGGAGAACCTTCAGGCTCCGGCGGCGGAAGCAAATTCGCCTCATGCGAAGCCAATACGGCGGAAGGTTAAGCCGTATGAAGGGAAGGAAGGCGAGAACC
TTCACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTTCGTGCTGCTTTTGCACTCTCCAACCTTAGCAGCCG
TGCTAAGAGTTGGATGTACACACGGGAGGCAGCATCCCCTGGATGTTTCACATCCTGGGATCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCCGGCG
AACTACGAGAACCGCCAGCGTTCGCGCTTCCTCTCGTGCAAACAAGGGAGGCGTGAGCTGCATGAGTACGTCCAAGAAATACGGGAGCTCACGGCGTCCC
TAGTGGGAAACCCACTCAGCGCACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCAGGTGCAGTCAAG
CACCCTTGAAGAGGCGATTCAAGTGACTCTTCAAGAAGAGTACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCATGGCCTGGGAGGTCCTTGTCGGCT
CCCGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGCGGGAAGATGGGCCACTTCA
AGCGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGC
TGGGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGACGGGTGCGCGGGTGGCGCATACCACGGGGACTTAGCCCCTGAGAGTC
TTCGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGATACGATCATCCCTTTAGAATCTTGATCGATTCTGG
GGCGTCGAAGAATTTCGCACGCCGTCAGACGGTTGCTCGTAATAGCAACAAGTTGTCCGATGATTTGAGAGAAGGCAAGGACAACGGGACGGTATCAGTG
CGACTGGCCGACGGGAAGGTCGTCACTGTCTCCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCGAACAGTTCACTGTTCTCG
ATATGGATCCATATGAAATGACCCTGGCCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGGGGCAAGGCAATCGGTGCCAGCCGCCCTGCGCATTGG
TGAGTCATGTTCTTACCTATGTCAGGACCCGGGGCGCCCGCAAGGGTTGCCAGGGTACCAAAGCATCCGGCAGATGCTTGGGAGTCGTCGACGTATATGA
CGACTCCGAGGATGTTTTGATGGTGGCAGCGCCCAGAATAGGCGCTGGCCAAGTGGATAACTTAGGTCCACAGGCGGGTAACTTAGATCCGCAGGCAGCT
GCAGCTGTCACGAACACTGAGAACAGCGTGTTCAGAGTGGGTAACAGAGTTCCACTCACGGTCGCCCAGACCTTAACTGAAGAGGAAGACGTCGGATACG
CTTCCTGTGTGGGTAACACAGTGCCACACGCGGTCGCCCAGACCTTAACTAAAGAGGAAGGCGTTGAACACGCTTCCTGTGTGGGTAACACAGTACCACA
CGCGGTCGCCCATACCTTAACTGAAGAGGAAGGCGTCGAACACGCTTCCTGTGTGGGTACCACGGTACCACACGAGGCCACAAGTGCCTCGGATGTCGTA
GCGCCGACATCCCTAGACGTGGGCAGCAAAGCTCGACGTCACAGTCGCCGTCGTCAACGACGCCGCCGCCGCCTCAAGTCGGATCCGAACTTCGTTCCGA
TCGACGTCGCTTCAAGCGACTCGGAGTCCAGGGCCCGTGTGGTGAAGTGCTTTCTCAGAAATAAGAGAATGGGCCTGACGCGGGGTCACTATCCCGAATC
AGTGACAATATCAATTGTTTGGCACGGGTGCAAGTTGCCTGTGGTGGATTAGCCACGACGAGCGGCACCCCGTATGGAATGACGATGGATCTGGTATGAG
CGATGTACGGGAAGGCAAGATCCACCAAGACTTATCTCGGATCCACCCTTACCTGGATTCACTTAGGTGGATATGGGATATACTATGTACCAGTNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN