Description :
From Genome Similarity Track
Location :
Scaffold_57:161489- 163855
Sequence
2366 bases(100 bases per row)
GCCTCGTAGGATGCTTACTCATCCTATGTTTTATGTCGTCGTCTCCGCCCGTAACATTATCACGATGTCTCTTCCTCGGGCGAATACAACCGCCACGCTC
AAGAACCTCCAAGATATTTTTTTGGTCCCGAGCCAGTTTCTCAATCTGGCTCTGTAGTGCCGCGTGCTGGCGACGAATGTCAGCCACTTCTTCGCGAAAG
GCTTGACGCTTCCGCTCGTTCTCCATTTGGTAGAACGCGAACTCCGATCGGTCGTCCGATCTATAAAGGCAGATGCGTTGCACCCACGCCTCTAAAGAGA
GACGCTCCTGCCTCTCTTATTAGGTGCGATCACACAGATCGTGTAAGCGTTGCTGGACACGACCAACCTCCGCCTACAACTCCAAGGGATTCGAAGTTGA
TATTCCCGCCCCTACCACAGCCATTGATGGATTCGCACGGTCATCAACGATTTCATGTGGAGCATATCTTGAACCACCGAGACGTGAAGGGGCAGCGAAC
GAGTTATCTTGTTCGCTGGCGCGGCTTTCCGCCGACGCACGACAGCTGGGAGCCTCGCGCCCAGCTGATGATTGACGTTAAGGGTCTCGTCCACCAGTAC
GACGAGACACATCCGATCGCTCATAAGGCCATCGGAGAACAAGCTTCCATGGCGCTGGTAGAGCGATTGCAGATTAGCAATCGCATCACACATATCAGAA
AAGATGTGCGCCCTACCCCAGGGTGAAGAAAGGGAGTACACCTCCCTGCTGATTCGTTCAGTGTTGTCGAAATAACACGGACACGCGTCGCCACACGTGA
GGCATGGAATTCCTGCCTCACGAGACAGCGTGTGCAATCTGACTTTTGCACCAGTCAAGGTTCGTTTCTTAAACCTGACACGAACTGTGTCAAGCTTCCG
AAGCCAATCTTCACGCCCAATGTGCTGCACATTGAGTATAAAGGCGTTCCACGCCTGCAGCAACGAACTTTTGTCTCGTTTAGTGTTGCCACTATACCAA
CGATGCTTCAGAAAAGCATCCAGATAGAAGTCCTCTTCAGCGCGAAAGTTACTAGCGCTGATGTCGAGTCCGTGGATCTGTCTCGCATCGAATAATGGAA
TTCGATGATGAAGACTTGTCTCGCCTGACAAGCCATTCACAAGCCTTTCTGGTAACACCCAAGGCTTGTGTTCAAGGGCAAGACGCAGCACATTGCCGTC
TAGAGCCTCCTGCGTGGTACCAACGGAAGCCTTGGTACCACTTGGATCCACATCACGACGGTTCAACTCATCACCGCATTCGCTATAAGGCGAATGTGTA
ACGGGGTGCCTCCGTTACATGATAATTTACTTAAGGTAAATATCAAATACGAATATTGCGTTAGGACAAACACAATATTCTCACAATATTATCCTAATAG
ATAATATTGCCCCGCGGATGTAACACACTGTTCATTGGTTGATATAGGATCAAGATATCAACCAATAAAGTCTAGCCACGACAGAAGCACGCAACGAGTG
GCGCGCAGATAGTTATAATGCATGTTTGTATTTAGACACGTTAAATGAAGTCAAATAGGGATTTATTACAAGGATTAACGATACTAAATACAGTTCTACT
TTTTACCTTTACTGAGTACTCTTACTCCGTATAGCAATTTTGCACGTACGTGTACGTGAGGTAGTCGGAAGCACACGCCCTTACACTGTCAGCAGTGCAA
GGTTTATTCAGTTACTTGAATAAGGTGTGCCCCGTTACACAGAAGACATAATCACTACGTGAATATGTGCGCGACCTTGGCCCCATCAATGGAAATCGGC
TAACCGAATAGTAGGCAGCTTGAGTCGGGTGGCTAGAGGTGCTCATACTCGGGAGCAGATTTGTATACGCGTCTTCTTCTGGGAAGCTATGACATCCCTG
TTACGCGATGCATAAGTCTGCTTCGATCAATCATCTGTGAAACAAGCCGTACTCTTCGAGATAAAAACGAAGGTGCGTTATGCGTTGGTTTTATCCGTAC
AACTTAGTCGTGCGATCGATATTCAGAAGTTATGCGCACGACACGGACACCTCAACGAGAGCCAGCTCAACAAAATGAAAGCAACTCGCTCAAAACCCGG
ATGTACATGGTCCAGGACACACCACAGCACGTCAGGATTTGACAAGCTGAAGAGTTGAGTCAGCACGTTCTCAGCAACTAACTGCGGCGTTGCATTCAAC
TGTGCGATCGATCGTTGAGCGTGGAAATGGCCACGAATGCGACTGTATTCGTACGGTTGAAATTGGCACACAGCGCTCTACCGTGCAACGCGCGAGTGGA
TTGGCGTGTCGCTCTTCGTCTCAAATAGACAGCTCAGCAAAAAAGGGTAGGGTGGACAATCAACAA