Description :
From Genome Similarity Track
Location :
Scaffold_570:16145- 18437
Sequence
2292 bases(100 bases per row)
TTGGTGCTGTGTTGGTGTAGGGTCTACAACTCTGCCGATGGTAAAACGCTGATGGTAGGCACTGATGAGACTATTCAGCTTGCCTTCGCGGTGCATCTGC
CGAAGAACCTTAAGCACAGCGTTGGATCCCTTTGACGGTACACCCTGCTCGCCTAGGAACACTGTGACTTTGTTTGACGCTAGCTCTCCGAGCTGACGTA
CTGTATCTTTGTAGCTGGATGATAACTCGTCGAGCGCGTACCCGTCTTCGATGAAGAGCCTCATGAAGGCCACGAGCTGCTTGGAATCCGATTTCTTGTG
CTTATTAGTACTCTGCCATCCACGCGGAACAGCCGTGTACCACGCAAACCACGTGTCAACAAGCGGTATTGTCTTGGATCGACGGCGACGCTTTACTGGT
ACGATTTCATCTTCGTCTCTTACTCGCTTGGCTTGATTATCTCGTGCTAAAGTTTCCCCTTCGGTGTTGTTCATTGCAGCTTCTAGCGAGTTAACTCGAG
CTTCAAGGCTACGGTTGACCTCAATTAACCTTTCAATTAAGGCAGTTTGATAATTCAACGCAGCGTTGGCCTTTACAATTCTTCAGTCATGGCTTCGGCG
GTGGTGTTGGCGTGTTCATTTGACGCTGTGAGCCGTTGTGACCATGCAAGCAGGTTGGTCGTCGTCACTCCAGAGGTTCCGCACATAGGTGAATTGTCTT
CATTGCAGGTGTCTTCGCGTTGATCTTCACTAACGACGGGTAGTGGAGGAGGAGGGTTGCTGTTAGCACATCTCTCACAACAGCGCAGACGCTAAAGGCC
TTGTTACCCAGATCATGGCTCGAGTTGAAAAGCTTCCGGCTAACCTCTCTAACCTTTTCTAGTGTTGCAGCGTCGAAGGATTTCAGGGGACGGGAGAGAA
GAGGCTTGCTTTGGCGTCATCCCACTCAGCACCTTAGCAACTTGATGATCTTCTTTAGGGGCGTTGAAGACGTACGCAAAGGCTTTGTTAGTCGTAGTCA
AGTTCCAAGCTCCGCGATCAAAGATCCATTGAGCTGCCAGCTCTTAGTTTGCGTTCGCGTGTTGCGCGCCGCCACGGCGAAACGAATGTGACGTCAGCGA
CACTTCGACTCCAGCAGGACCAGCAACGCGATCGAGCACGCGGTTGACAAGAGCGTGGATTCCAACTCGCGTGAGCAGTGGTGCTACCTGGCGACGTCTG
AGAAGAATTCGGGGCACTATTGTCGTCAAGAAGTTCCAGTAATGGTATCGAGGCAGCTAGGTCAACAGGAACGTCCTTCGACTTCGCCGGCAAATGGTTT
AGCAACGCTGCACACGGAGACTCATGCGTAATCAAGGCCAGCGCGAGCGCTAGCAGCGGACAAGTCATGAAGTCAGCGTCAGGAAAAAGTGACAGTGACT
GCTCATCGGACGTCTTCACGCGGATGAATCGGATAAAGAAAACCCCTCCAGCTCCGACGGAGAGCTGCTGCTACCGGACGAACGTAATGTCTGATGCACG
GCCGAAGAGGTACCACAGGAGGCACAACAACGCAGCATCTTGGTAGTCCGACGCACAGCGAGCCGTTGAATATAAGTAGCGTATCATCTTCTTGAGATCC
TCTTTTGTGCACGCAATAGCCTTCTTGACGAACCCACCACTTTCACGCTTGCTGCAGTGCTGTTCAAGGGTACGCCCCATGCTGAGCAGCTGTCGTGCTA
CAGCGCCACCTTGAACAGGATACTCATCCAAAAGCCAGCATTTGACCTGGCGGAAGTATTGAGCGACGGAGTGGCGCGACAGAGGCTTCTCCTTTGCTCC
AGCGTGGAATGCCAAGTACACACCAAACTTGTCCATTAGAGTCACTAGTATACTACTCGCGCGACTAGAGTCTGCGACGATCAAAGCCACGACGTGCTCC
ATGGTAGTATTCTCTAAAGACAGGAAGCGCTCAAACGCTTTTAAAGCCGTCGCACGCGCGCGCTTTGTGTTGGCGGGCTTCAAGTCGCTCATTGTTCTTG
GTCGGAGAGGTAGAAATATGCAGGTGATACGTGGCAAACCTTTAGCAAGTATTACTATACACATATCTGGTCGTCAACTTCGACTAGATACGTCGGAATC
GCTCAGCTTCCGACTGCACCCTAAACTATAGTTTTAATTGGATATAATTGTATTCTTGAAGCAATTTGATTCGCCCAATGAAACGGAGATCGCTTTAATT
GGCTATAAAGAATAAGAAACGATTATCATTGGCTAGTGCGCAAGATACTAAAAGTAAGATACGTCGGAGAGATAATGTTATTCATCCATACC