Description :
From Genome Similarity Track
Location :
contig_40:16144- 18626
Transcript NameFunction/comments
g7313.t1hypothetical protein

Sequence
2482 bases(100 bases per row)
GCACCCGAAGCGAGCGATGGCCCTTCATGTGCAGTATGCGAAAACGCAACCTGCGCCGGTCCTGAGCAGGAGTCTCAGGACGCGTCCGACGTGGTCGAGC
ATGGGTTCCCACGTCCCGATGAGCAGTGGTTCTCGGATGAAGACGATGATGACGTGGTCGAGCATGGTTTCCCACGTCCGGATGAGCAGTGGCTCTCCCC
CGAAGAAGAAGATGACGTGGTCGAGCATGGGTTCCCACGTCCGAGTGATGATGTGGTTGAGCGTGGCCTCCCACTTGCGGTCGAGCATGGATTCCCGCGG
GTGGTCGAGCGAGAGCTCCCCGAAGAAGTTGACGCGGCCGAACACTGGCTCCGCGTCTTGGTGCCGATGTCGAGTTCCGGCACCCCGAGTCTGCTGACGT
GATCGAGCATGGGTTCTCACTGTCAGCTGTGGAAGACTCTCCACGCCCGGTTCGTCGTCGCGGTCGTCGTAAACCGCGACGACCTCGTGCGCCGTCGCGG
GATCCAGTCGAAGCTGAGACCGAGATGATCTCAGTCCTGGTGGGGAATGACGCGGACGAACCTCCGCGTGCGTGCAACGTCGAGGTCGCACGTCCTCCAT
GCGACGCTGCCGAGATCACTCGACTGCCTGGCCTCTCGTGGAAACATTTCCTTCGCGACTTGAAGAAGGGCGAGATCGAACAAGTGTGCATGATCGTCGC
CGAAGACGCCGCATCCATCGCAGCCGTCGAGACCCACGCATCGGACTCAACGTCCGACGCTCGCACACGTCCGAAAGGTGCTGAGCCAAAGAACGCCCGC
GCAGCACGATACGCTGCCCAGTCGTTGCCGGCTCTAGAGGCTGCCGGCAACCCAGTCGCTCCTCTTGTACGCGAGTTCAGCGACATCTTTCCGGACAAGG
TTCCAGCCGCCCTTCCACCCGATCGTGGCGTTCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTGTGACGCGGCAGTGGCCGCTTCCCCGAGA
TCAAGTCGAAGCGATCGACGCTTTCTTCGAAGGTCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCCGCATTCCAGCCCGACGTTCTGCGTGAAG
AAAGCCACCGGCGGATGGCGGATCGTCCACGCCTTCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACGCCGATTCCGAGGAAAGACATGGTGCTCG
ACACCATGTCCGGCAGCACCAAGTTCAGCGCCATCGACCTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGCCGACGTGCCGTTGACTGCCGTCAG
CACGCCCAGTGGAATGCTCTGGGAATGGCTCGTGATGCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAATCGCATGGTGTCAAATCTGCTCCGGCCG
TTCCGCGACTTTGCGCCCAGCTACTTCGACGACATCTTCATTCACAGTCGTGCCGCGGGCGGCATGACGGACGTCGAGATGCACCTTCAACACCTGAGGC
AGGTGTTCGAAGTGATGAGGGAGAACAAGCTGTATGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGATCCCAGTGCTCGGGAGCTACGTCAGCAC
GGAAGGTGTCCGTGCTGACCCGGAGAAGATCGAAGCCATCTGCGCTTGGCCCGCTCCTCAGGATCAGAAGCAGCTCCGGCAGTGGCTTGGTCTCGCGACG
TACCTCCACCACTACTCGAAGAACTTCGCGGCAATGATCCGTCCGTTGTCGCAGCTTCTGAAGGCAGATGCCGCGTGGTCGTGGCGTCCTGAGCACCAGT
CGGCTTTTGACGCGGTGAAGACGAGCTTGTCCACCGCGCCCGTACTCATGCTTCCAGACCACTCGAAGCCCTTCCATGTCGTGTGCGACGCGAGCGACTT
CGCGATCGGCTGCGCCTTGATGCAGTTCGATGACGAAGGGCGCGAGCGGGTCATCAGTTACCAGTCGCGCCAGCTGAAGCCGGCAGAGCGGAATTATCCG
GTCCATGATAAGGAGCTGCTGGCCATGCGGTACGCCCTCATCAAGTTCCGCGTATATCTCCTCGGCGAGCAGACCTTCGCGATCTACACCGACCACGCGT
CGTTGAGAACAGCGACGAAGAGCCCTCACTTGTCCCAGCGCATGGCGCGCTGGCTCTCGCTATTCTCCGAGTACAACTTCGTCGTCCACTACAAGCCGGG
CAAGGCCAACATCCTCGCCGACGCGCTCTCGCGTCGGCCAGACTACGTGCAGTCGGTCGACACGCAGTTGGCGACGAGGATGACGACGAGTGCGCTGTGT
GTGTTGCTGAAGAGGTCGCTGCAGTGGAAGTCGCAGCGACTACTCCACTCCGAGACCTGATATCGGCCGCGTACGAGGCGGACGCGGCGTGCTCCGAGAT
GATCAAGTACTTGGGAGACCCGTCCGACACGGCGCGGCGCCGATTGTCCGCACGGAGCCGTGCCCGCATTGATCGATACCAA