Description :
From Genome Similarity Track
Location :
Scaffold_1322:1614- 4367
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_1322-fgenesh-gene-0.0Potassium/sodium hyperpolarization-activated cyclic nucleotide-gated channel

Sequence
2753 bases(100 bases per row)
ATGATTGTGCGCAGGAGTTTGAACACGCGCGCGAGCTTGAGCAGCCGGATCGCGCGGAAGAAGAAGATCGAACGCGATCCCGTCTGGTTCGGCACCCAGC
ACCGCATGACCGCGGACACGGGAAATACGGACACAAAGTCCACGAAGAACCAGCTGCGCAAGTACACACGCGCGATCCCCCAGGGCGACGTGATCAGGCG
GCTGCCTCGATCCACGATCGCGGTCCGGAAGTTGAGCAAAATGTCGACAGTGAACATGATCTCAATCGCGACCTCGAGGTTCACGATCCACGGGGTCTGG
TCGGACGCGTCCGAGAGGAACGTGATCTCAAACGGAATCGCAGCGGCGCAGTAGATCAGCTGGACGCCGATGAAGCAGTCCCACGCGAGCTTGTGTGCGT
GGTCCGGACTGATCGGACTCCTTAATCGGCATTTAAACTTTTCAAAGGACGAAATTTCATCATTGTGCGACAAGATGTCGATCATGCGCTGCTTTTCGGT
GACGGAGTTGAACACCGAGACCCCCATCGAGAGGTCGAGCGTCATTTTTTGCAGAATCGGGATCGGCACCGAGCGGTAGGACGTCAGGACACCATCCAGC
AACACAGTCAGCGTCGGGTACACGTTCTCAACCCCGATCAGTTCGGACACGGGGTCGCTCTTCTGGGAACTCAGGTACACGCGATACCGCGCAAGCGTCT
GCTGGAACACGCGGTCGTAGAGCGCACTGCGATCCTGGTGGTACGTGAGCAACGTCTGCTCCACGTCAGGGAATTCCTCGATGAGCCGGTCGAAGTCCTC
TTTCGGCAGCGTGTAGAGGTCGCAGCTCGACTTTGCCGTGTACGAGTTCTGGTGCAAAGTGTAGTTGAGCAGCGAGGATTCGCCAAAGATGCCATGCTCT
GTCAAGATCTCGAGCACGACGATCCACTCGTTGTTCGGCGCAGTTCGCTTGACTTCGATGACACCCGAGTTCAGGATAAACATCTCGGTGCCGACCGAGT
TCTCCTTTGCCAACACATCGCCTGCCACTGCGATCAGTGGCTTGATGTACATCGCCATGTCCATGACGAACTGCGTACTCAGTCGCTGGAACGCTGGGAT
GAGGAAAAACGAGTTCTTGTACGTCTCTTGCAACACTTCGCCACGCAGCGACAGCGAGAACTCGCACAGCAGCTCGCGCTCGTCGAAAGCACTCGTCTTT
GCGATGTAGTGACGGAAATACCGCAGCAAGTTGCTCTTGAGCTGCTTCGGAATCGCTTTTTTCTTGACAAACTCCTGCACGATGCCCAGCTTCCGTGCTC
GTGTCGTGGTCTCTCGGTTCCAGTTCTCCAGGATCTTTGTGATGTTCGCAATGATGATTCCGAATCCACCCGCACCGATCACCATCGTGACCATGGAGTA
TAGCCGCTCATCGGTGTTGGTCGCGTGGATATCTCCGTAGCCAACGCCTGCAACCGTGGTGATGACCCAATAGAAGCTGTACAGGTAGCGCACTTGGGCC
GTTTCTCCGGCAAGGTCGATCGAGGTGATCCACGTCACTTCCATGATGTCCTCAGGGTAGCCAACGTAATGCCAAAAGCACGTTAGCACATGCACGACGA
GCATCACTTGGCTGATGAGCTCGGTCATGCGCGTGAGCACTGCGTCGAGCTCCAGGACGTCTTCCATTTTCATCGCAAACTGGCGCAGCTTGATCAGTCG
CGCGAGCTTCGTGATGCGCACGAGCCGGATCATGCGCGCGAGCTTGAGCGACAGCACCGAGTTGTCTCGCGATTCCGTATTGACTCCGTTGAGCACATAG
TCGGCGGGGATGACGGCCAGCACGTCCGGGATGAACCACGACGTGAGGTATTTCTTGGCGATCTGCCGTCGGTCGCGCACCATGGGCTCTTCCTCGCTCA
CGTAGAAGCCGACGAAGAAGTTCTGCACGACGTCGAGGCTGAAGAGGACGTCCATGAGAATCGAAATCGTCTGCCAGCTCACGCCGAACACGAGATCCGG
GAAGCCGACCTCGATCGGGATCAGAATGGCGCTGTAAAGCACGATCACCATGATTAGCGAGTCCCACATGAGCTTGGAGTTCGTACGCGGGTCGAGGATT
GGCACCGACAGGCACGGGATGTGGCGGCGATGCTGATTGTAGAACTTGCTCCACTGGAGCGTCACGCGCGAGTGGTGGTTCGTTTCTTCTGCCAGTACGC
AAACAGATGCCCGAGATTGGTGTGACCGCCCGCCATTGACTGAACCCTCGGCAAAAGAACCTCTGGTGGACCCCGTTCGACCCACAGAGCCTCGTTCGCC
TGTGGAGCCTCGACTAACAGAGCCTCGTTCATCCGTAGAGCCCTCTCGTTCGCCGGATCCGTCTCGCTCGACAGGGCCCTGCCTTGGAGGCGTTAGCACC
ACTGGAAAAGACCCCACAACGTGCGAGCTCCTTCGTGCGCCGGCACCCACCGGAGAAATCGCTGGCGTCACTTTTGTCAGCTTGACGTTACTGGGAGACG
CCGGCGACATGCCCAACCTGTCTGAACCTTGATTCGGCGATGTCTCGAGCGCAGGCAATGGCACGACATGACTCTTCTTTCGATTCGTTCCAGTCGATGC
AGATCGAATCAGTTGAGGCGGGGAAGCCTTTCGCACAGAGCCTGGGATCAACTTCGCGGTCGGCGAGAGTGCTGTCAAGCGCTGGACTTCTAAAGCTTCA
TCCATCCATGCAGTCGCCGAGCGCGTGAACTCCCTCTCCACGCGGGCAATCAC