Description :
From Genome Similarity Track
Location :
Scaffold_354:16139- 18161
Transcript NameFunction/comments
Phymu_g9001hypothetical protein PHYSODRAFT_515521

Sequence
2022 bases(100 bases per row)
TATATCCTAGCGATCAGTTCGACGTGCTATTCCTTACGTAGTACGGCTCGTCCTGGTACTCGGCTGAGCAGTACGGGAACGTGGCAGAGTCGTCGTCCGG
GTTGAACAGGTTCTTTCCGGCATAGATCATAACGTAGCAGCCCACGACAGCACAAACGGTGGAGATCGTGATGCAAATGGCCTTCTCCCAAATTGGGATT
TTTGTCCAGAATACCTTCACGTAGAAGATAAGCGGCAGGATCAGACTGCATACAGTGATGGCGGTGGCGCCGGTGAAGTCCACGAGGTCGAGGAAGTTGT
CCTTCAGCAGAATTGAGGCGACGGTCAGAATCGCGATCAAAGCGATCCGCACCAGGACGTAACGGATCACGTTCACACTGCCCTTGTACTCGGAGAGGTC
ATCCTCGCTCTTCGTGGTCGAAACACGCTGGTCCTGCAGCGCAGCCGTGTTACTCTCAAGGTCTGCgggagaagacgcagcgagGTACGACATtttctcc
tcgatctcgattCCACGCTCCTCGTTGTCGGTAGGCAGGGGGTCAACCTTGTGCATGCCCAACACGAGACGCTCCGCCATGTAGAAAGCCGGGTGGAGGA
TAGTCGAGAAGGCGATAGACAAGTGAAGCTGCATGAATAGGTACGACATGACCACTGCACCACGGTTGGCCGTGAAACCCAGGGTAGTAGTGCTGTACGG
GTCCGACGTATTCACGATCGAAAAGAGAAGGTTGCCCGAGAGCTGGCATCCACCTGCAACGTAACCGATGATGGCGATACCGAGGAAGAAGGCCGAGGCC
AGACCCAAGCTGACAACAATGACGCGGGGCATACGATCCGGCTGCGAGTGTTGACGCTGGAGATCCGGAATCACGATAGCGGCGGCGTACGCAAGCGACA
GGTTGCCAAACGTAGTCAGCACCTGGTGAAGCGTCACATCAGGCGTAGGGGGCGTAGGGTGTCCGCGCTCCTCGTACAGGAGGATCGCAACACCGATGAC
ATCAGCAATGATCGTGCCAAGGCATCCAGCGACAGCCATGCTGGCACTCTCCTTCAGGGTTGGGATCAGCGCCACAGGGATCACCAGCGCAGCCATGAAA
ATGATCCACACCGTTTGGCTGAACGAGTCGGGGAACAGCACATCGAGCAAAGTGCCGCCAAGCACGAGGAACGCACACGGCGCAAGCAGACACACACCCA
TGTGCGacaccaccacgaagaacCGACCCCACTGGCCGGCGACCCACTCGCCAAGGTCGCCGTACGTCCTCACCGAGGCAGGGGCGACCATAAGGACCTT
GGAAAGCAGCACCGTGGCGTAAATGTTGGCAAACGccatgaagagcagcgcaacgGTGGCATATCCCCATCCAGCTCGGGCGTAATTGGACGGCATACCG
AGCGAGCCGATACCacagatgcagcagaagatgttGAACGCAATCTTGGCATCTTCGAGCGTGAAGAGAGCAGAGCGGGTGgttgacgatgaagttgcCA
TCGTGCTTGTCGGGCAGACAGGAAAATGGACAATGACTCAACGTGCCGGTGCTTTGACTGGAGAGCGGGCGcggcagccagcagcattttccCTTGTTTG
CGCAAATAGTTGAAAGACCACGCGCTGTGCCTTCGTCCGTCTACACGCGTCGTTGCCGTTGTCGCAGTGCACAGGAAGTGCGCCAGCATCAGAGCACGGG
CCGGTAACGGTTCTACGCTCGCAGTTCCTAGACGTAGACCGGCGAAATGTGATCGCGCAATGCAACAGCACGCCCTCGATTTCTGAAACGACATCGTTGC
GTTAATGCGTTAATCCGTAgcaaagctgctgctttccgGGTGATGTACATGCACAAGTATCTGTGCGCTTCTGTCCAGTCGTTCGTCCACATAGCAGAAT
GGCGAAAATGGCGGGACATGCAACAGATCCCGTCACATCCGGAAGCATCTCGCAAAAGCATCCCCAAAGCTGTAGCCGAATGGATGTCGCCGAATGAAGT
tcagtactgtacatacGGTGCA