Description :
From Genome Similarity Track
Location :
Scaffold_350:16139- 17354
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_350-snap-gene-0.20Pre-mRNA-splicing factor SF2

Sequence
1215 bases(100 bases per row)
GGGCCAACACGGCTCAGCTTCAGCACCACTCGGCGCCGCGAGCTAGCTGGCCGACACAGCAGTCCCGCCGTGATCCAGCGAGGCGATCCACTTAGTTGAA
CGCTCATTCGGGACACTCCCTCCGCACTTGGCTCTTGACCGCTTAGGCTTCGTCCTGGACCGGAGCAGGCGACGACGCGGCAGGAGCGGGAGAGGCCGAG
CGCGAACGCGAGCGACGCGGCGACTCCTTGCGGGCCTCCGGCGAGCGCGAGCGGGAGCGGCGAGGCGAGCTCGAGCGGCGCGGCGAACGCGAACGCGAGC
GGCGCTCGCTGCTGTCGCCCTCGGCCGTGATGCGCACGTAGCTGCCGCGGAAGTCCGTGTCATCCAGCTTCTTGATGGCGTTCTCCATGTCGTCGCGCGA
CTGGAACTCGGCAATGCTGTCAATCAAAATACACCCGCGTCAGATGATCAAGATGGAAGAGGCGACCACTGTCAGTCTGGTAAAGCAGAGAGCCACACGT
ACGCCGAGCCGTCGTTCTCCACGTTGCAGTACGTGACCTCGCCACCGCCGCGCAGGAAGTCCTTGACGTTGCGCCAGTCCACGCCGCGCGGCAGGTCCGT
CACGCGCACGCGGAAGTCCGTGCGCTGCGGCGGGTTGCCACGAGCGGCTGCCTCGTCAACCAACATAAACACAGATCCGAGCGTTAGCCTTTCAACCGCA
CACTGCTTCCACACACTCGAGTTCCTCCTGAACGCACCGCCGCGGTCGAAGCGGTCGCCCCCACGGCCGAAGCGGTCGTCGTCACGGCGATCGCCGCCGC
GGTCGTTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTCCACGCGGATGCTGCAAACAAGTCAACACAGTCAGCAATACG
TCCTCCACACTATTACCACAAAGATTCAACACGCACCGTCCGCCGAGGAAGTCGCGGCCGTCCATGGAGCGGATGGCGTCGTCGGCGTCGCGCGGGTCCT
CGAAGTCCTACGAGCAGTGGCGCAACGGCGCGGCAGACACGACGACGGAGAGCGGAGTGTTGGTTGATGGATCGAGCGTGGGGGGGATGATGGAGGACGA
GCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCATGATGGCAACGAGGCGACGGCTGACGGTGCAGCGGAGCGAGGC
CCGAAGGTCGACCAC