Description :
From Genome Similarity Track
Location :
Scaffold_2:1613849- 1621866
Sequence
8017 bases(100 bases per row)
AGTTCGTGTACTCCTGCTTCCTCTGTTACGAAGTGCTGTGTGCCCCGTCACACTTGGTAGCACTTGTAGTCAATCCTACGCCTACGCGGGTAGATTGGAC
TACCTGAATCCTCTGTGGTCTCATCGAGTGAGCCAAGATGGATCGTACGGAGTTTCCCCATCTGAACGACTCGCAGTACAAGTCCGTTCGTAAGATGGCA
GCATCTTTGGGACAGATGCCCAGCGTAGCTTAGCGGCGGCGACGCCGGCTGAGCAGGTTGAGCGTATCAACGCGTTCGACACCTACGAGCGATGGCTCAT
CGCCCACGTTCAAGGGCTGCAGGACACTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGCGGCCGCGCCGAAGCCGGTGCAACCGAAGCCCCTGC
GGCTGAAGGTTCACCCCTTCAAAGGGAAGGGAGGAGAAAACCTTCACTTCTGGGTTCGAGAGGTTGATCTCGCGATGGACGCGGCTCTCGTCTCGGACGA
GCGACTCCGTGTCGCCTTTGCGCTCTCCAACCTTAGTGGTCGCGCTAAGAGTTGGGCGTATACGCGCGAAGCGACGACGCCTGGATGTTTCGCATCATGG
TCCCAGCTGTGCGAGCAGCTGCGGGCCGCGTTTCTCCCGGCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCCTGCAAACAAGGAAGGCGCGAGC
TGCATGAGTACATCCAGGAGATGCGAGTGCTCACTGCCTCTTTGGTGGGGAACCCCCTGCCTGAACACATCAAGGTGACCGTGTTCATGGACGGTCTGCG
TGTCGGTCCTGCCCGCACGCAACTGTTCCGTGTGCAAGCAAACACTATGGAGGAGGCGATTCAGATCGCCCTCCAGGAGGAGTACAGCCACAAGCAGGCT
CGTACCCCCGCCACGGTATGGCAGAGCAACCCTGCCTCTGGCGGTGCGCCTAATGGAAACGCCGGCAATGGAGCGATCAACGGGTCGGTTCCCATGGATC
TGGGCATGGCCGAGCAGAGCGACATTCGCTGCTACGGCTGTGGCAAGCTTGGGCACATGAAACGTGCTTGTCCCGCGGGAGGACTGAAGAAGAAGTTCTC
TTCGAAGCCCTTTGGCTCTAGGGGTCGCTGGCAGAAGCCGCGCCCCAGAAACCAGGGGAACGCCGGACACCAGTAGGGGCGGGGCGCCCTACTGGGGAAA
CACTAAGTCTTCATGAGGGGCGTGCGGGTGGCGCACACCATGGGGACTTAGCCCCTGAGAGTCTCTGTACTCTTGAAGCGGAGAAGGGCAGCGGTGGGCT
GCTTGTGGTGCACGCGAGTGTACCGGGATACGATCATCCCATGAGAATCTTGATCGACTCTGGGGCGTTCAAGAACTTTGCGCGCCGCCAGACTGTCGCA
CGCAATCGCGACAAGTACGCCGATGCGCTACGAGGCAGCTAAGGCAACGGGCTGGTCTCGGTAAGACTGGCCGACGGTACGGTGGTAGAAGTACCTCGGG
TCCACATGGACCTCACTGTCAAGTTCGAGGACTTCGACAGCACGGAGCCGTTCTTGGTCCTTGACATGGACAAGCACGACTTGATCCTTGGTATGCCGTG
GCTGGAGAAACACGAGCCTTGGATCGACTGGCGCGGCAAGGCCATCGGGGCCAGCCGTCCCCCACGGCCTGACAGAGCTTTGGTGAGTCATGTTCCCACC
TCTGGCAGCAGCTGGGGCGCCCACGAGGGCCGCCAGGGCGCAGCAGCGTCTAATGAGTTCTTGGGGTCCGTCGAGACTGACGACGACTGCGACCGGGCCG
GACAAGGCCTGAGAGTGGAGGTGCCGGACAGCACCTAACGTAGGTCCACATGCGGGTAACGAAGTACCGCAGGCAGCAAGGGCTGCTGGAGAAGGCGCCG
CTGGCGTTGGCGTGGGTAACCAAGTTCCACGCGAGGTCACTCAGACCGTAACTGATGAGGAAGGCACTGCAGGCGCTTCCGATGTGGGTAACATAGTTCC
ACAGGAGGTCACTCAGACCATAACTGATGCGGGAGTCGCTGGAAGCGCTCCTGGTGTGGGTAACCAAGTTCCACACGGCGAGGTGGGTAACATAGTTCCA
CCCAGCAAGGCGGGTAACGTAGTTCCGCACGAGATCGAGAAGATCGGTGGTGCCGTCAAGGCGGCGCCACGAGACGAAGACACCCAAGGGTCACGTCGTA
AGCCGGGCCTAGTCGTGTGGCCGACGACGCCAGTCGCCAGCGACTCCGAGCCTCCAGCCAAGGCTCCAGCCGCCGAAGAGTGTTATCACATCTTCGACGG
CGTGACCGGTAGTCGGGTCAAGACAGGAGCTGTCGAGCTTACAGCTCTGCCCGAGGTTTCAGAGTTGCTGAACCTTGAGGAGCTCGCCATGGAGGACTTC
TTGGCCGAGCTAAAGGCCGGGGAAATCGCAGAGTTGGTTCTCCTCCGACCGGAGTCCACGTCGGCCGAGTTGAACTCGTCCTCGGTCATGGACCAGGCAG
TCCTGGAGGAGTTCCAGAGACAGTGCGCGTCGCGCATGGGCTCTGAGATTCTTAAGAACCCCCGGGACCCGGTGTACCCCTTGGTGAAGGAGTTTGAGGA
CGTGGTGTCCAAGGATCCACCGTCCAATCTCCCTCCGACAGGGGAATCAGGCACGAGATCGATCTCGTGCCGGGCACGAAGTACTGTGTCACGAGGCAAT
GGCCTCTTCCCCGGGAGCAGTGTGAAGTCATTGATGCCTTCTTTGCCGCCAAGGCGAAGGCAGGCATGGTGCGGGAGTCGAAGTCCCCGCACTCGACGCC
TACCTTCTGTGTTCGCAAACCGAACGGAAAGTGGCGTCTGGTTCATGCTTATCACAAGCTGAACAGCGCGACAGTGCCTGAGCAGACACCGATCCCGCGC
AAGGACGTGTTGCTCAACAACGTGGCCGGCTGCACGCTGTATAGCGCGCTGGACCTGGTGGACGGATACTACCAGATCCTCATGCGCGAGAGCGACATCC
CACTCACGGCTGTGAGCACGCCGAGCGGTATGCTCTAGGAGTGGTTGATCATGCCTCAGGGACTTTCTAACGCCCCGGCAACGTTCAATCGCTTGGTCAC
ACAACTGTTCCGACCTTTGCGTGCGTTCACACAGACGTACTTTGACGAAATCTTCGTCCACAGCCGGGCCGAGGCAGGCCAAACGGCCATGGAGGTGCAT
CTCCAGCACCTTCGACGTGCGTTCGAAGTCATGCGGGCGAACAAGCTGTACGCCAACATCGACAAGTGTGTGTTCGCAGCTGAGGAGATCAAGGTCCTGG
GCTGCTTCGTCAGCAGCGCCGGGGTCCGGGCGGACCCGGAGAAGGTGAAAACCATCGCGGCTTGGCCGCCACCTCGGGGGCAGAAGGACCTACGACAGTG
GTTGGGCCTCGCTAACTACCTGCACAAGTATAGTGCAGGCTACGCCGAGCTGGCACGGCCCTTATCGGATCTCCTGAAGAAGGATGTCGACTGGCGCTGG
GAGCGTCGCCATCAAGATGCATTTAACGACATCAAAGCGAGGTTACAGCGCGCGCCAGTCCTGGCATTACCGGACGAGACGAAGCCTTTCAGCGTAGTCT
GTGATGCGTCTGACTACGCAATTGGCTGTGCGCTATTGCAGGCCGACGATAAAGGCCGCGAACGGGTCATCTCGTTCCAGTCCAGGCAGCTCAAGGCAAC
CGAACGGAACTATCCAGTCCACGTCAAGGAGCTACTAACCATGAAGTACGCTCCTGGGCTCGACGCCCTTTGTCGTTTATACAGACCACGCGTCATTGCG
GACTGCCGTCAACACGCCGCATCTCTCACAGCGGATGGCGCGTTGGCTGTCATTCTTCGCGGAATACAACTTCCGTGTCGAGTACAAGCCGGGCAAGTTG
AACGTGCTTGCCGACGCGCTGTCGCGCCGACCCGACTACGAGCTTGCTCATATTAGTCGGGTCACGACGGATCGGTATGATCGCATCAGGCTGGGGTACC
GAGCCTGATGCGATCATACAGATCCGATGCCAGTCTCGAACCTCTTGTGCGGTTCTTGGCCGCTGGCTCGGAAGCCAAGGCCGAGTGGCTCACGCCCCGA
CAACGTGCAAGGCTGCGCCGCTATGAGTGGGCTGACGGTTTGCTCCACTACATGGTAGAGCCCGAGGATCCTCCCCGTATTGTCGCGCCCAACGACGAGG
TTCTCAAAGTACGACATCCTGATGGAGGCGCACGACGCTCCATCCAGTGGCCATCTCGGCCGTGAGAAGACGTACGCGCCTGTCTCGCAGATGTTTTGGT
GACGTCACATGTACAAGTGGGTCGCCACATACGTCCGTACGTGCGAGACGTGCCAGCGCGTGAAGCCTGTCGGTCACGCCTCGGCACCATTGCAGAGCCT
GCCGGTCCCAGCGGACTGCTGGAAGTCGATGAGTCTCGACTTTGTCTTCGGACTTCCGGCCGATGACCGTGGCAACACTGGTGTTGTTGCCTTCGTGTGC
CGTCTGAGCAAGATGGTCCACTTTGCTCCAGTTCGTGACACCGTCACTGGCGACGAGGTCGCTCGCCTGTTCATGGACTGTGTCTTCCGACACCACGGTC
TGCCCGAGACCATTGTCTCTGATCGAGACCCGCGGTTCACCGCTACGTTCTGGCAGACGCTGTTTCTCCTTCTCGGCACACGACTGTCGATGTCGACGGC
GGACCACCCGCAGACGGATGGACAGACGGAGCGCGTGAATCGCGTGCTCGAGGACACGCTCCGCAGTATCTGCGCGGAGATGCCCCGCTCTTGGGCTGAT
CGCTTGCCCATGGTTGAGTTCGCACTCAACAATGCGGTACATGCATCGACGGACTTTATGCCCTTTTACCTGAACGGGTTGCGCCATCCTCAGGTGCCGC
TCACATTACGAGGCAGTACCGGGGCTTCGGTCCTAAGTGGGGGAGAGGCTCGGAAAACCTTTTCCTCCCAAGTCTCGGACGTGAGTCCAGCCACCTTGCG
GAAGCAACTGTCCTCGTTTGCCGATGACAGGCTGAACATAATCAGTAGGGTGCGAGACACCATGGCGCAAGCCCAAGATAAACAGAAGGAGTACTCTGAC
CGAAATGGAAGAGGAAACATGGACGTGTTTAAGGTTGGGGATTTAGTTCTCCTAGATACTAGAAACCTACCGCTAAACACTGTTAGCTCGGTCGAGAGCA
ACAAGCTGAAGCACCGCTTCATTGGACCCTTAACGGTCCTCAGCCGGCATGGCGCGGCGTACACCATAGACTTGCCCAAGTCGATGACGACTCACCCGAC
GTTTTACGTGGGTCGTCTTAAGAGGTACCATGACCCTCTGGCTCTGGCTGCCCCGCAGGAAGCGGTGGGTGGCCCGGTGGAGAAGAGCGCAGCTCCTCGA
AGCGCGGCGTCGAGTCGCGGTAAGGCGCCTGATACGCGCGCTGGTCGTAAGACGGCGCGGCGTACATCGGAGCAGCATACGCAGGGGCCCCGTACGAGCC
CTGGCCAAACTGGGCCTGATACGAGTGGGGCTGCTGCTGCTCCGGATACGGCGCGTGGCCATGAAGCTCGGCCCGAAGACCAGCGAGCTGGTTTCGCAGC
GAGTCTTAAGACGACAGGTCGGCTCGACGATCCACACGGCCATGGAGACTGCGAGTTTCTTGATAGAGCGAGGCAACATCCTCACGGAGCCGCTCCACGG
CACCAGGCTGACCAGCACGAGCGGAAGCCTCGCCACCAAGGCCGACGCCAAGCGCGATCTCGAGGACGTACACACGGTCCCGGAGAAGACGAATCTCCTC
TTGCTGCAAGGCCACCACCTGACTCGGGGCCCCAGCATACGGCTGCGTCGCCTCAGGCTCGTAGCCATGGCCGTGCGAGGCCACCGCCGGCCCTCCTTGA
TCGTAATGGGCAGATCCACTACCACGTGGAACGAGTCGTCCGGGAGCGGCGGCTCCATGGCAAGCGCCAGCTGCTCGTGAAGTGGAGGGGTTACCCTGAG
TCGGATAACTTGTGGGAGCCCGTTGAGCAGCTCCAGGCAGACTGCCCGAAGCCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCT
TGGCTTCTTGGCCGGTACCCGGGGCACGGTAGCAGACGTAGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCGTCAGCTCGTCC
ATCTTCGAGTGGAGCTTGCGCTTACTCACGAGGTGAGCGAACTCGATGCGGAGCTCGCGCACGTCCAGTATTGCGGACAGAGTGCGATCCTCACGGAGTT
CTTTGAACTCTTGGTCAGAATACCCTTTGCGCTGGACGTAGCGCCAGAAGAGGTCTTCCACCTCGCACCAGGTCATGTTGTCATTCGGCTTGACCCAGTG
GAAACCCCACACAGGATGGAGTCCACCCTTGTCCTCCGGCTTCTTGCGAAGCGTGGTGAACTCCTTCAGTGTGAGCTTGTGTGGTGCTAGTAGCACACAC
CGGGCGACTTCAACGTCGCCAAGAAAGAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCGATAAGGCCACGACGAG
CCGAGAGCTTCTCCAACAGCGCTGGCGCACCAGTGCCAGGCTCGGGCGGGAAGTAGCCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGC
AGTCGTGGCAGTCGGCTGCCTGGCATACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGCGG
ACGGCATCTTCCTCGTCCTCAGACTCCGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGG
CGGCCTTCGCAGCGGCAGCCGCTTTCGACGCTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTGGATGCCAGCACCTCCTTGGGCTTGGAGCC
CGCGTCGCTCGGCGACTTCTCGGCCACGACCCCAGCGTCGGCCATGGTGACTTCGTCGTGCGACTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCC
GCCTCCTTCTCTGACGAGGCCTTTGCGTCGGCCGAGGCGTTGGTCATGTCGCCTGCCACCAGCTCCGTGCCTTCGGCAGCGTGCGTGCTGCCCTCCGAGA
CGTTCTCGTCGTCGAGTGAACTCTCACCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGG
ACTCTTCTCCTTGCCTTGCGCGGCGTCAGGAGACTTGCTCCGAGCCCCGGCCTGACGGCCACTCTCCGGCGTGCTGCTACGAGAGCGCACCACCTCCTCG
GCCGCCTTCGTGGCCTCCATCAGCGCGGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGTCCGCGGTTTCGGAGGTGCTTTCGCAC
TGCGCGCACTGCGCTTTGGAGGCATGCTTCCGGTTGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGG
CGCCAGAGCTCGCGCCGTTTTCGATGGATTTCGACTTTACGAGTGAAATGTGAGTCGCCGGCGTAACCTCGCAATGATTGGTCGATAAGATCGAATCTAA
GTGGGGGAGGATGTAACGGGGTTACATGTAATAGTGACTCTGTCACTATTCCGGGATGGCTACATCGGTCACTCCCCTGGATAGTGACCCAAGTGGCCTC
AGAGCCAACAGATACATTTTGTAGGACACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTGTAAATACATTCAGTCTTAGA
TCTACCGCTTTTCAAGTCAAGTCGTCCCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGAGTTCGTGTACTCCTGCTTCCTCTGTTAAGAAGTG
CCGTGTGCCCTGTCACA