Description :
From Genome Similarity Track
Location :
Scaffold_70:16138- 22577
Transcript NameFunction/comments
Pytiw_DAOMBR242034maker-piw_contig_70-snap-gene-0.20Ankyrin repeat domain-containing protein ENSP00000383090
Pytiw_DAOMBR242034maker-piw_contig_70-fgenesh-gene-0.12Conserved gene of unknown function
Pytiw_DAOMBR242034maker-piw_contig_70-fgenesh-gene-0.6Histidyl-tRNA synthetase

Sequence
6439 bases(100 bases per row)
AGGCGAACAACCGCAGCAGGCGCGCCCAGCGACGGCGAGAAGCGCCATCACCAAGAGTAAGCCCTTTGTGCCGCTGCCGCCATCGAAGAACTGGCGCATC
ATGGCGCTCCGCTCCACCGGCCAACTTAGTCGCCTCATGCAGGCGGCGCTGCTCAAGACCCTACTGCACGCGATCCGTCGCGGGTCTGTGGAGGGCGTCA
AGGTCGCGATCGAGCGCGGCGTGTCGGTTCAATACATCGACAGTCGGAGCCGCAACATGATCATGTACGTTGGTGCTATGCGATGAGTGGGCGAGTCGAA
TCTGCACATGGAACTTGCAGACCCGCTGACATTCTTTGCTGTTTCTTGCACAGGCTTGCGTCGAAATGTGATACGGATGCGAGATTGCAGATCGCGATCA
TCTTGTGTGATGCTGGCTGCGACATCAATCACAAGGACCAGTTGGGATGGAGCTGCTTGCACTACGCCTGCGCCAGTGGAGCTCTTGATGTCGCCACCGA
ATTGATTCGCCGGTACGTCTATGAGATCTATTTTTTCCTGATACGTCGTGAAGAAGGCTGACTGAAAGTGTTGATGGACTACACAGAGGCGCTCGCGTGG
AATACAATCCGTACGGGTACGGCCCAGAGGACTTCGTCATCCCGAAGGTGGTGCGAGCAAAGAGCCTGCTGCAGCATACGGAGCAGCTCCAGCACGAAGT
GAACGTGAAGACGTGCTGGGATTTCTTTCGAAAAAACTCGGAGAAATCTGGATATGGCGTGAAATGCCGCTCGGTGAGTTAGAATCGTGTTTTGTAGCGC
TGAAGAGTTGAAGACATTATTTCTAACTTTGGTTGTTGTTATATAGCACTGTGATTTGGGAAAGCCACTGCGAGTCAAGTTCCAGGCGCCGCAGGGTCAC
AGTCCACTGGACCGAATTCGCGTTATCGACATGAACTCGGACGTCGCGCTCTGGTTGCAAGTGTCCAAGAGCTTCAGCATCCCACCTGGAAATGTTGGCT
CGATCACGCTCGACTCGGAGACGCTGGACCGACCATCTCTCTACCGAGTCTTTTACGAAAAGTACGAGCCAACTCCGATCAAGTTGCCTGCTGAGGTGGC
GGAAAACAACTTCTCCATCAGGAACCTGGACACGGGGATCACTGTCTCCGTCGGAAGCGTGAACGAGCTGGTGCTGCGTGAACTGAACAGCACGCGCAAC
GCACGGAAGACCAAGCAGCTATCCAATTCCTCCAGGTGCGTTTGCAGATGTGCTGCAATATGATCTTCTCTGATTCACTGCTAACTAACTGAATTTCTTT
GTTGTACAGGGAAGCGCCGAACTCGCAGACGAACGACCCGATGCCTCGACGGATGTCAACAACGTAAGTCCTCTCGTCCTGCGACCTTATACTGCAAGTT
TACTAGGTGTCGCTGACTCTACTTTTCTTACTGCTTTTGCAGGCGCATGCGCAATGCCACAACTGAGACCGAGCGAGAAGAAACGGAAGTGGAAGAGTCG
GAATTCGCAGCTGAAGAGACAATCACGATGACGGAGATCGCCGAGCACCCAGCTGTGCACAGCATCACGGGAGTGTACAAGCTTGTGGGGATGGCGATTG
TGAGCGTGTCCACGCTCCAGCGAGTGAAGGCGAATGAGTATGAAGTCGTCATCAAGAACAGCGGCACGATGGGGCTTCAACTGGTACGGATTTGTATCTC
GTTCTGCTACGTCGCGAGATGAAAAACCCGTGCTTACAGTGTTATTTTTTTTGGCTTGTTTGCAGGAACCGAAGCGTGACGCGAAGATGAGATCCACGAA
GCTCATCGTCCGCCGCAGCTCGGGGCAAACTGCTGCAGTCAACCCTGGCGACTGCTTGGTGGCGATCGGTCGAGCTAACATCGAGCACGCTGGTCTGAAA
CACACGCTGTGGGAGCTGAACGAGGCCAAGCGTCCGCTGGTGCTGCGCTTCCGACGGGGCAACGCGAACGAAAAGAAAAGCCTCTTCGCGAGCATCCGCA
AGCTCTCTGGTCCACGGCCGCTGGCTGCCATCGCTGTGTAGTTTGTCCGAGAGCATGAATATTAGACTAGGGAAAGAAGTGAGAGGCTCACAAAGGCGGC
GAGAAAGACAGGAAAGAAGCAAGGCATGCGTTTACTCTGGGAATTGTTTAATTGAAATTGAATTTATGTGACAGCAAAGCAAGTGCTATGGTGGTGGAAT
GTACATTTATTTTCACGAGAGTCCCTTGTGAGACTGAGTTCGTCAGAGCATGGGGTGTCCCTTTTCAACATGACAGTAATGAAAAGACTTGCCTCGACGC
GCGCAGAAGCCACAGATCTTGCCAGACGTCGAGCAAACGTCGATCACGTGCAGCGGGTTGTTCTGATCACCAAACAAAGAAAATGACAACAAACCCAGCT
TGGTTAGTTCTTTAATAGCAATTCCTTCGACAAGTGAACCGAGTGCCACCTCCCTTACCTTGAAATGCTCCAGCAGGTCATTCGGATGCACCTGCATCGT
CGTGCCTGCCTGTGCATCGAGGACCGTCGCGGGGTCTGCTTGGCCCGTGGCCCGCCAGACGTACCAGACCTGCGCCTCCCACCACGCAGGCTCCTCGGAT
CCTGCATTCTGGTACTGCAACAGATCAGAAGTCACAACATCATAAAGTTAGCATGAGCATACTCATAGCAATAGGATCAACTGAAAAACGCACCGCGACG
GCCACGAACGAGCCCGGCCGGAGCTTGATCGCCCACTCCTTCACCTGCTGGCCGAAGACCTTTGGCGCACGGCCGCGCTTGTAGGCCTCGCGTAGCAGCC
ACTCGCCGTCCTTGCCATTTGCGCGCCTGTGAAGCCACGGCTCGTGCTGGTGGAACTTCCACGTGTTTGGAAGCACCACGAGCGACGGGTCGTTTGGGTC
AACCTCCACGATGCCGAACGTCCAGTGCGCGAACTCGGTGCGCATCTGGCCGGTCTTGTAGCCCGTATAGTAAACCAGCAGCCGGTGCACCTGTAGCATA
ATAATAACAGCATTAGTTGACACAAAAAGAAATCATACTCATGCATTTAAGAACCATCAATACAACGTACGCAGTTCATCTGCACGTGCATGTACCGCGT
CCAGGTCTCGGTATCTGCCTTCTCTTCCTTCATGATGATCTCGGCGCGCGACGGTACCGCCACGAACGCCCGCGTCCCGCGCTCAGCGATCATCTCGATC
TCTTTCTTCATCGTTTTGCTCACCTACAAACAGCGAAACAAAACAATAAACTCTCATCAGTCAGTAAAGCATAGCTCTAGCACAAGCAACATCACGCAGC
ACGCACCATGCTAAGCTTGGCGAGCTCTGCGGGCTGCAAGAACATGGCGAGCAGCTGCTTGACCTCGGTGTCGAGGAGCTGCAGGTTCGTCGCCGCGCGG
ATGCGGCGAATGGCCATGAGCGCCCTTTTCTTCTTCGATGGTGAGTCCGTGATGCTGGCATCGTCACCACCTGGCTTCCCATTGATCACAGCCATAGCCA
CTGGTCTGTCCTCCGCTGCGCCGCCCTCGTCGCCGTCGTCGTCGCGCGTCGGCTTCTTCTTCCTGCGCTGCGCGACGAGGTTCTTCTGGAAGTACGCGCT
CTGCAAGCGCAGGAAGCACGAGCAGACCTCGCGCCGGTTGCAGCTGCGTGTGTGGATCCTTTTCTCCGTGTTCTGCGGCGGCGGCGCCATTTCTAGAGCG
GGTTCTCCGCCCGCGCTCGTCGCCGCGACGTCCGCCTCCACTGGCTTCGCCTCCTGCTCCATTTTCCTCGCCTGTTGAATTAGCGAACAGCCACTGGCGA
GACATGTGGGATTCAGCACCTCTGTGCATGCATGCCTCACTTCCGGATATTTTGCTATGCGAAACTGAGTTATGCATGCAGAATATTCATTTGAACAAGA
GCTGCAAGACAAATTATGGAAACAAAGTATTTTTTACAGTATTTACTTGTTCCATTTGCTATGCGTAAATTGGATATGCACCAAGAGGTGTAGATAGCAT
TGCTCGACTCGATTGGCAGATGAAAATGTGGCGTGGAAGCGTGTCATGTGCAGCAGCAGCAGCAGTGCGCCGCCGCTCGTCGCTGAGCAGCGTGCGCTTG
GCCTCGTCCGCCGCTGCTGCAGCTGGTAGTAAAGCGAAAGCGAAAGCGACAGCGGTCAGTCGTGTGCGCGGCACCCGTGACTTGCTCGCGGAAGAAGCCG
AGCAGCACCAGCAAGTGCTCCAAGTACTGCAGCGAACAGTGGGCGGCTATGGATTCCGACCAGTGCGTCATACGCTTTACTTTTAATCTAGGGTTGCGTG
CACTGCATGGCGGCGCTGTATTCTGACTCGTGTGGACTGGTGCATGCAGATTCAAACCCCGCTTCTCGAGTACACGGACCTCTTCTCGCGCTCGCTCGGG
GACGGATCCGATATCGTCATGAAGGTGAGTCTGACTGACATTTCCAGTAACCATTGACCGTGTGGCTACGCCCAAATGCGCGAGTCATTTTCACAATTGT
TTTGTGTATCGAAAACGTGTCTGTCCGCGCGGGCTGTTGCTACAGGAAATGTACACTTTCAAGGACAACTCGGGCAAGAGCGTGACGCTGCGACCGGAAG
GCACTGCTGGTACTGCACGCATCGTTATCTGTTGGCGTCTGCTGTGGTTGGCATTTCCGCTAACAATGTGATCTGCTGCGCTATCGTTTGTACCTTTGGA
TAGGGATCGTTCGCGCGCTGCTGAGCAACAACCTCATGTTCTCGCTGCCGCAGAAAGTTACGTACTCCGGGAGCATGTTCCGGTGCGTCTCGACCGCTTG
AATGCGGTTAATTTGCTGGACATAACTGATACTAACGTGTGATCAACTATTCTTAATAGCTACGAACGTCCGCAGCGTGGTCGATACCGTGAATTTCAGC
AATTCGGTACGTTTGAATGAATTGCAAAGGCCACAAGTGATCTGAGCTAAGTTCTGTCGAAATGGGTCGCAACTTTCTAACTGTCTGCACTCGTGTACAC
GGCAGGTGTCGAGTTCGTGGGCTCCTCGGGGCCATCAGTCGATGTTGAAGTGAGTGTCCATGAAAATTCGCAAGTGAGCGAGTTTCAGGTACTAAAATAG
GTGTGTTTACCTATAATAGGTGATCGCAATGGCAGCCGACGCCTTGCAAGCACTGGGGATCCGCAACAAGGCTGTGCTGGAGCTCAACTCGCTCGGCGAT
GCCGAAAGGTACCGTCGGTTTCTAGAGATAGCTATCAGATCCGATCTGCGATGCCGAACTGACCACAACCCCGCTTGTATTCGCAGCCGCGGACGCTACC
GCATCGCGCTTGAGGACTATTTCTCTCAGTACAAGAGCGAGCTCTCGGCAGACAGCATCAACCGGTTCGTGCAGAATACTATCGAGACAAGACCTTGAAA
TATCTGAGGATACCCACACACACTGAATTGACTCGTGACTCTTTATCTGTGTGTCATTTGTACAGACTGGAACGTGGAAGTGTGTTGCGCATCCTGGACT
CCAAGAGCGAAGAAGACAAGAAATTCGTTGTCGACGCGCCTCGTTTGGAAACGTACCTGTCGAAGGAGGCATCGGAGCGCTTTGACGCAGTGCTGAACGG
GCTCGAGGCGCTCGGCATTCGCTATCGCCACAACGCCCGTCTCGTGCGAGGACTGGTGCGTGATTTGTATTATTTTTGCATGTATTCGATTAAGAATCTG
CGTGCTGACTTGGTGGCTGGATGACCAATATCACCAGGACTACTACAGTCACACGGTGTTCGAGTTTGTCGAGAACTTGTCGACTGGCGATGAAGGAGAA
GCCGGCACTGGGGGCATCGCTGTCCTTGCGGGCGGGTGCTATGACAACCTCTCGGAGACGCTGGGTGGGCCGCCCGTGTCTTGCATCGGCTGGGCTGCTG
GGGTCGATCGCCTTCATCTGCTTCGCGAGACGAGCGCCGTGCAATCCAACACCATCGCTGTAAGGTTTTGTATTGGATTGTATAACCTGCATGTGAATCG
AGTGGCTGACTCCAATGGAATCATTATTGTTTGCAGGTTGTCCCCGTGCTTGTCGGCGATGACCAAGATGCAGTGCTGCATGAGGCCATGCGCGTAGCCC
ATGTACGATGGCTCATACAGCTCTTGCTCGCTTGATGAACTATGAGCTTACGTAATAACGTACTCGTAAATTTGAATTTGCTACTGCAGACGCTGCGCCA
GCGAGGACTCACTGTGCACTTCTGCCACGGCCGGGGCAACCTCAAGAAGCAGATGAAGGTGATATAGTCATCATGGAGATGTGTTTATCTACTGTGTAGT
GTAGTTCTCACAGAACTTTTGGTTTATTTGTTTGAGTAGGCTGCGGAGAAGTCTGGCTGCTTGCACGCGGTGATCCTGGGCAGCGAAGAGGTCCAGAGCA
AGTTCGTGAAGGTCAAGAACCTCGACAAGCGACAAGAAG