Description :
From Genome Similarity Track
Location :
Scaffold_57:161335- 163952
Sequence
2617 bases(100 bases per row)
GTTCTCTATTTAATGTCGGAGACTTAGTTCTACTGTCTACGGTAAATCTACCTAAGCACGTAGTAACAAATGTGGGTAGTAGTAAACTATTACCCAATTA
CATCGGGCCGTTCCGTGTACTACATCGCAAAGGCAATGCATACACTATCGAGCTGCCTCGTAGGATGCTTACTCATCCTATGTTTTATGTCGTCGTCTCC
GCCCGTAACATTATCACGATGTCTCTTCCTCGGGCGAATACAACCGCCACGCTCAAGAACCTCCAAGATATTTTTTTGGTCCCGAGCCAGTTTCTCAATC
TGGCTCTGTAGTGCCGCGTGCTGGCGACGAATGTCAGCCACTTCTTCGCGAAAGGCTTGACGCTTCCGCTCGTTCTCCATTTGGTAGAACGCGAACTCCG
ATCGGTCGTCCGATCTATAAAGGCAGATGCGTTGCACCCACGCCTCTAAAGAGAGACGCTCCTGCCTCTCTTATTAGGTGCGATCACACAGATCGTGTAA
GCGTTGCTGGACACGACCAACCTCCGCCTACAACTCCAAGGGATTCGAAGTTGATATTCCCGCCCCTACCACAGCCATTGATGGATTCGCACGGTCATCA
ACGATTTCATGTGGAGCATATCTTGAACCACCGAGACGTGAAGGGGCAGCGAACGAGTTATCTTGTTCGCTGGCGCGGCTTTCCGCCGACGCACGACAGC
TGGGAGCCTCGCGCCCAGCTGATGATTGACGTTAAGGGTCTCGTCCACCAGTACGACGAGACACATCCGATCGCTCATAAGGCCATCGGAGAACAAGCTT
CCATGGCGCTGGTAGAGCGATTGCAGATTAGCAATCGCATCACACATATCAGAAAAGATGTGCGCCCTACCCCAGGGTGAAGAAAGGGAGTACACCTCCC
TGCTGATTCGTTCAGTGTTGTCGAAATAACACGGACACGCGTCGCCACACGTGAGGCATGGAATTCCTGCCTCACGAGACAGCGTGTGCAATCTGACTTT
TGCACCAGTCAAGGTTCGTTTCTTAAACCTGACACGAACTGTGTCAAGCTTCCGAAGCCAATCTTCACGCCCAATGTGCTGCACATTGAGTATAAAGGCG
TTCCACGCCTGCAGCAACGAACTTTTGTCTCGTTTAGTGTTGCCACTATACCAACGATGCTTCAGAAAAGCATCCAGATAGAAGTCCTCTTCAGCGCGAA
AGTTACTAGCGCTGATGTCGAGTCCGTGGATCTGTCTCGCATCGAATAATGGAATTCGATGATGAAGACTTGTCTCGCCTGACAAGCCATTCACAAGCCT
TTCTGGTAACACCCAAGGCTTGTGTTCAAGGGCAAGACGCAGCACATTGCCGTCTAGAGCCTCCTGCGTGGTACCAACGGAAGCCTTGGTACCACTTGGA
TCCACATCACGACGGTTCAACTCATCACCGCATTCGCTATAAGGCGAATGTGTAACGGGGTGCCTCCGTTACATGATAATTTACTTAAGGTAAATATCAA
ATACGAATATTGCGTTAGGACAAACACAATATTCTCACAATATTATCCTAATAGATAATATTGCCCCGCGGATGTAACACACTGTTCATTGGTTGATATA
GGATCAAGATATCAACCAATAAAGTCTAGCCACGACAGAAGCACGCAACGAGTGGCGCGCAGATAGTTATAATGCATGTTTGTATTTAGACACGTTAAAT
GAAGTCAAATAGGGATTTATTACAAGGATTAACGATACTAAATACAGTTCTACTTTTTACCTTTACTGAGTACTCTTACTCCGTATAGCAATTTTGCACG
TACGTGTACGTGAGGTAGTCGGAAGCACACGCCCTTACACTGTCAGCAGTGCAAGGTTTATTCAGTTACTTGAATAAGGTGTGCCCCGTTACACAGAAGA
CATAATCACTACGTGAATATGTGCGCGACCTTGGCCCCATCAATGGAAATCGGCTAACCGAATAGTAGGCAGCTTGAGTCGGGTGGCTAGAGGTGCTCAT
ACTCGGGAGCAGATTTGTATACGCGTCTTCTTCTGGGAAGCTATGACATCCCTGTTACGCGATGCATAAGTCTGCTTCGATCAATCATCTGTGAAACAAG
CCGTACTCTTCGAGATAAAAACGAAGGTGCGTTATGCGTTGGTTTTATCCGTACAACTTAGTCGTGCGATCGATATTCAGAAGTTATGCGCACGACACGG
ACACCTCAACGAGAGCCAGCTCAACAAAATGAAAGCAACTCGCTCAAAACCCGGATGTACATGGTCCAGGACACACCACAGCACGTCAGGATTTGACAAG
CTGAAGAGTTGAGTCAGCACGTTCTCAGCAACTAACTGCGGCGTTGCATTCAACTGTGCGATCGATCGTTGAGCGTGGAAATGGCCACGAATGCGACTGT
ATTCGTACGGTTGAAATTGGCACACAGCGCTCTACCGTGCAACGCGCGAGTGGATTGGCGTGTCGCTCTTCGTCTCAAATAGACAGCTCAGCAAAAAAGG
GTAGGGTGGACAATCAACAAAGTGTCCCGACAAGTGTCCCATTTAGCAAGTGGCGCATGCGCTGGACCTACACATGTGAGGTGCCACCCAAGAATAATTG
CCACTCAAGCTGCACCT