Description :
From Genome Similarity Track
Location :
Scaffold_348:16130- 18200
Transcript NameFunction/comments
g9550.t1hypothetical protein

Sequence
2070 bases(100 bases per row)
TTCCGGACAAGGTTCCAGCCGCCCTTCCACCCGATCGTGGCGTTCGGCACGAGATCGACCTCGTGCCAGGCGCGAAGTACTGTGTGACGCGGCAGTGGCC
GCTTCCCCGAGATCAAGTCGAAGCGATCGACGCTTTCTTCGAAGGTCGCCGGCAAGCCGGCCACGTCCGCGAGAGTCTGTCCCCGCATTCCAGCCCGACG
TTCTGCGTGAAGAAAGCCACCGGCGGATGGCGGATCGTCCACGCCTTCAACAAGCTCAACGACGCCACCATCCCGGCGCAGACGCCGATTCCGAGGAAAG
ACATGGTGCTCGACACCATGTCCGGCAGCACCAAGTTCAGCGCCATCGACCTGATGGATGGCTTCTACCAGATCTTGATGCGCGAAGCCGACGTGCCGTT
GACTGCCGTCAGCACGCCCAGTGGAATGCTCTGGGAATGGCTCGTGATGCCGCAGGGGCTCAAGAACGCCCCTGCCACCTTCAATCGCATGGTGTCAAAT
CTGCTCCGGCCGTTCCGCGACTTTGCGCCCAGCTACTTCGACGACATCTTCATTCACAGTCGTGCCGCGGGCGGCGTGACGGACGTCGAGATGCACCTTC
AACACCTGAGGCAGGTGTTCGAAGTGATGAGGGAGAACAAGCTGTATGCCAACTTGAAGAAGTGCATCTTCTGCGCTCCCGAGATCCCAGTGCTCGGGAG
CTACGTCAGCACGGAAGGTGTCCGTGCTGACCCGGAGAAGATCGAAGCCATCTGCGCTTGGCCCGCTCCTCAGGATCAGAAGCAGCTCCGGCAGTGGCTT
GGTCTCGCGACGTACCTCCACCACTACTCGAAGAACTTCGCGGCAATGATCCGTCCGTTGTCGCAGCTTCTGAAGGCAGATGCCGCGTGGTCGTGGCGTC
CTGAGCACCAGTCGGCTTTTGACGCGGTGAAGACGAGCTTGTCCACCGCGCCCGTACTCATGCTTCCAGACCACTCGAAGCCCTTCCATGTCGTGTGCGA
CGCGAGCGACTTCGCGATCGGCTGCGCCTTGATGCAGTTCGATGACGAAGGGCGCGAGCGGGTCATCAGTTACCAGTCGCGCCAGCTGAAGCCGGCAGAG
CGGAATTATCCGGTCCATGATAAGGAGCTGCTGGCCATGCGGTACGCCCTCATCAAGTTCCGCGTATATCTCCTCGGCGAGCAGACCTTCGCGATCTACA
CCGACCACGCGTCGTTGAGAACAGCGACGAAGAGCCCTCACTTGTCCCAGCGCATGGCGCGCTGGCTCTCGCTATTCTCCGAGTACAACTTCGTCGTCCA
CTACAAGCCGGGCAAGGCCAACATCCTCGCCGACGCGCTCTCGCGTCGGCCAGACTACGTGCAGTCGGGTCGACACGCAGTTGGCGACGAGGATGACGAC
GAGTGCGCTGTGTGTGTTGCTGAAGAGGTCGCTGCAGTGGAAGTCGCAGCGACTACTCCACTCCGAGACCTGATATCGGCCGCGTACGAGGCGGACGGCG
TGCTCCGAGATGATCAAGTACTTGGGAGACCCGTCCGACACGGCGCGGCGCCGATTGTCCGCACGGAGCCGTGCCCGCATTGATCGATACCAACTGGAAG
GAGGCCTGCTGACATACAGCGTCGATCGCGCCGATCCGCCGCGCATCGTCGTCCCGCTGGACGATGACCTTCGGGTTCGGCTGATTCACGAGTTCCATGA
CGCTCCCAGCGGCGGCCACCTCGGACGCGAGAAGACTTTCGCGTCGCTCTCGCGAGACTTCTATTGGCCGCACATGTACAAGTGGGTGCGGAAGTGGGTA
CGCTCCTGCGAAGCGTGCCAACGAGTCAAGCCGCCGCAGTCGAAGCAGGCCCCGCTTCGACCCCTCCCAGTTGCGGCGGATCCGTGGTCTTCCGTGAGTA
TGGACTTTGTCTTCGGGCTGCCTCGAGATGCTCAAGGCCGCACTGGGATTCTCGTCTTCGTAGATCGTTTCAGCAAGATGCTTCATCTTGCTCCGGTCGC
TGTCACCATCACCGCGGCGCAGTCCGCGGCGATCTTTCTCGACATCGTCTACAGGCACCATGGACTGCCG