Description :
From Genome Similarity Track
Location :
Scaffold_314:1613- 3337
Transcript NameFunction/comments
Pytir_DAOMBR486maker-pir_contig_314-fgenesh-gene-0.4Transmembrane protein
Pytir_DAOMBR486maker-pir_contig_314-snap-gene-0.15Gene of unknown function

Sequence
1724 bases(100 bases per row)
ATGTGTCTGCCGAGAGCCACACGCGCGTGCGCAGCATGTCGCGCACTTTCGGGTTCGAGATGCCGATGAACTCGCTGCGGAAGCTGTTAGGGCTCGCGCA
GCCGTAGATCGTCGTGTGGTAGACGCCCAGGGTTTCGTTGGGCCAGACGAAGCCCTCGAGACAGACCATCTTGCGTAGCGGATAACTTCGGCTGACCATG
TCGAGGAACGTCGTGAGCTCTTTCTCTTCCGCGCTGCCTTCTTGCGCCAGGTCGTCGATGTTCACGGTGATGTCGGGGAACATGTACCGGTTCAGGAAAT
CGGTCGAAATGTGGTCCTGACAGATGGACGGCTGCTGCGACGGGAAGAGTAGCTTGCAGCACGTCCAGACAATCGAATCGAGCCGCACAACGCTGGCGGC
GATGATGTTCTGCGCCGTAAGCATCGCGGCGCCGTGGCCGAGTGTGCAGTTCATGCCGAGCACGAGCACCACAAAGCCCCCGCCGCTGTCGAACGCCGTG
AAGTTGCCGCACGTGGACAGAAAATGCGGCCATGAGGACATCGCGCTTTCGGATTTTGTAAACTCGGAGCTCATCGCCACCATCGGCGACTCGCGCAGGA
CGCCGTATGTCGCTGTCCGGAACGAATTCGTGTCCGACGGACCGACGTACCGGATCTTGTAGTCCAGGTCCAGGATCAGCAGCACAAGGAGCACCAGCAA
GACGGCGGTGTAGAGGAACAGCGGCAGGTGCAGCTTCACGGGCGAGCGAGTCGCCACCGTCATCACCATCTAGCGTCTCTATATGGTCTGATACCGAGAT
GGCAGAGGGTCTTCAGCAATCCGGAAGTGCTGGTTCTGGGCTGAGACGGCTCGGTAATTATATCGCAGGAGCAAGCAACGCAGGAGCACTTGGCAGCGTC
AACTCAACAAGCCAACAGTCTGACGGCTCTCAAAAAAGAAAAAAAGCCCCGAGTGCCTATCGTGATGTGGCGAGAGCAAACAGAGGCTTTTCTATTTGAG
CCTCGCGCTCAAAGTGCTCCTCTAAAATATCGCGCAACACCAGCGGCTCAGAGAGCAAACAGAGGCGTGACGCGCGTTGCATGTTCGCAGAAGACAACGC
AAACTTTATTAAACGCTACGCTACACAGCCCACTCGCTACACTACGCTGCACACGCACAGACCACGACACCACTGCCAACGGCAAACACCTAGAATCCTA
AATACATAGCTACCGTAGTTCTACAAACACATATAATACTTCTCCAAGCTTTCGTTCGCTTGAGGCTGAGAGGAGTTTACTGATCGAAGCGCGGTCGCTT
GGTTGGGAACAGCGGCAGCGGGAGCGCCGTAGGCGATCGGCCGCGCAGACTCGGATCGTCGCTCACGACACGACGTAGGGATACTGGACCGCCATAGGAC
GACGGGCTGAGCGCTCGCATCGATGGGGACCCGCTGCTCGCCTGTGGAGAACTGTGCTGCTGTTGCTGGAGAAAGAGCGGCGTGAGCGACTCGCAGTGCT
GCATCGCCCAGGAGAACTCGGACCGCAGCATGCCGCAGACCTGGCAGCTCTCGGGGAAGTTTTGTGCGCGGCAGATGCGGAAGTGGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCAGCAGGTGCTTAGCCTGCGAGCAGGATGCGTGGCAGTCGCCGTCGCCCAAGAAGCACTCCTGGCAGTGGTCGAGCACGCCGCGC
GCGATGCTGCAGTTGGGCACGTTG