Description :
From Genome Similarity Track
Location :
Scaffold_394:1613- 2624
Transcript NameFunction/comments
Phyra_85960endo-1,3(4)-beta-glucanase, putative

Sequence
1011 bases(100 bases per row)
TCCAGCGTGTCGATGTGGTGGACCTGGGCGTAGTGCAGCAAACCGTTTCCACAGTCGCCGCTGGTCTTCCACACGTACGCGTAGGCGTCTTCATTGTGGG
CTTCAACACGGCCACCGTCGAGGACGCAGCCCGCCGTCTGGTCGAAGACGTTCTGCTCTTGCGCAGAGGCATCGGGGATCAGCGCAACACGAGCAATGCC
AGTGAATGGGCGCTCCATGTCGAGCACAGAGTGGCCATCAAAGTGCAGCGCGACCGGAGAAGAGAAGTACAGCGTCCAGGTTGCGCCGTTGTCGAACTGC
AGCACGAAGCGGCTGTTGGTAAGAGGAAGGCTGACGGTCTCCGTGGCGTCCAGGCCGTTGATGGTCGAGATGTTGTACGCCGTCTGGAACCGCGGCGTCA
GCTCAGTGTATCGAGCAGTGACGAAGGCCATGCCGCTTGCGAGAGTCACCTCGATCTTCTTCGCATCATCTTCACGGGACATGAAGCGGAGCTGCACGCT
CAGATCGTCCCAGTCGAACACCTCGAAGCTCGGGTGCGAGGAGTCGGAGAACTCGGTGGCGGAGAAGGTAAACTCGGGCACTTGGCCGTGCAGGTAGTAC
ATCTCGGCATCGCCGTTTCCGGTCAGGCCGCCTCCGAACTCACGCGTCGTGTACGGGTAGTTCATGGTCAGGCCGTAGGGCTCCATGGCGATGCAAGGGG
TCACGCTGTACGGGTTGGTCCACACGGGTTGGATGACGTCGGTTTTCTCGCCGACCGTGGCGCCGATCAGGTTGCCCCACCAGTCATTGGTCGGGATAGG
ACGCGAGCCCACGAGGCCGGGGGCCAGGAACTTGGGCGGCAAGAGCGTCTTGTGCGCGTCGGTGTGGTTGAAGAGGTTCTGGGGCGGGGCTTCGGCGTTG
AAGATGGGCGTGAACAAGTCGAACTTGGCGTCGGGCGCCACTGTAGTCACGCTCCGCAGCGTGGACGCGCCGGGGTGGAAGATGCCGAAGACTGCGGCGG
CGACGAGCAGC