Description :
From Genome Similarity Track
Location :
Scaffold_65:161282- 163548
Transcript NameFunction/comments
Phyca_LT1534510708Hypothetical protein
Phyca_LT1534574787Rab32 family GTPase, putative

Sequence
2266 bases(100 bases per row)
gccaatagtacgcagcagaccgcgtccctagcaccaccatccaaaactgcagatttggagaaattgctacgctggtttcctacaaacgatcacgttctcg
ttggtaagctagcagaccgaatcgaagatgctcttgcaatcgaagacgctctcatttgcgcgcggatcgggaaatgcgaagagcccgtgtgtcgctctgt
gtttatacactatgagcactgcaagcgcgacgaaatgtgtggtgacccaaagtgctctgagatctcaaccattcataaacaccgacgtacgtgcttagag
aaagagaatgcagctacgacggatggcaagaagtttgtgtgcccgttttgcattcgcattcggcagcgacgaagcatcggggtgtgtgcagcgttggatt
atctcatctgtgaccagcgtcgggcacttcaaggtacgcacacggaagcaacccgcaatttttgcttgcaaagtatcaacaggtggaccgagcgccagca
actccttcgcgcagaaactgataagcttaatcaacttgccagagagtgcggcatcccggtgtttaacttcccgaagtaccagtggcacttcagtgatgta
tttatcaaacgagaaccaacagaggttggtaatagtttggctcagggatctgcaattccagaagatatggaagggcacgacttcgctcaaggtatgcacg
aactggaattgagaggtggcatgattctcttcataactttgtttacttgtgcatggcagataacggagcaagcgatgagcaaacacaagacagacaagag
gagagcataccaggaactgcgaatttcaacgcaggttatatcaaccagctactgcggaacaaacaagacggagataacagtgaggcagcccaacaggagt
ttgacaaagtcgtggatttgggctgtgccattgtggacgcatcgttttgctccccttcgaaagcgcgacggtgtcttctgaactgtaaggccattcttga
tcacctgcagcaccacttagatctgcaggtgtgcaaccaaccgatgtgcaaagcagtggagcaccacttcgcgcatctgtcacaatgcaaagctcgagac
gaaagtaaatcttgcgaatactgcttgttaacggaggagcatcaattgatccgctccgtggatttcatggaggcggagcaatcagaggctgaagcaaggg
tgcagaagatcatttatgatatgacggcctctgtcaatatccagagtccgcatgagcaggagcaggagctgatacaactggaggacgagttagagcaagc
cgaaaccaacaagcaggagttgctggagaaactcgacgctgaacggacgaacctccgtgatgtgcgcaataacttggagcgtcgtggcatttcaaactca
cacaatcgacgtctacctttgcacttcacgaagatgcactcggaaggccaagtaagcaacaaaaagcgacgtcttgctgactagggatgctatatacccc
ctttgatccatagataataagattttagtgggaacttgtcaaagttagattaatgctccaagtatgatatgcatcgacaggactgctgtgtcgagtagga
agaattctgctgcggttatggggagatggtaggtgttagaagctgctgcagcaccagctggattggcttgaattgcccccgttagctgcactcgtggggc
ggaacgtgtcattacgcttcttggcgtctgacttccgctcgaagatgtcctggtgctccaggatgcccgtcactagcgccttggcagcatcgtcaatgtg
gatgttctctttggctgaagtgtcgaaccagcccgtaaagttgttggtcttgcagaactcgtccaggaagtccctgtcgatttcctccttcaagtcacac
tacagtgcatcagttacaattagttcacctaaagctgcagaggacaaagagagagagacagcaacataccttgttgccacacaaaatgaccggcaatggc
ttgccattgggcagctccactttagagtcaatctccttcttccactgtaacatcaaccaacaccatcagcaccaactctttaaataccaagcacccttcc
tctcccgaaccttaaggatgctgtcaaacgtctcggggcgtgacatgtcatagaccagtaatgcccccaacgcgtccttgtagtagactcgattaagcgc
gcgaaaatgctcctggccagcaatatcccacaactgcaagcgcaccgtcgtaccgctgacagtcac