Description :
From Genome Similarity Track
Location :
Scaffold_191:16128- 21793
Sequence
5665 bases(100 bases per row)
TACTTCTTAAGTCGCCCGACGTAGAACGTCGGGTGTAGTCGTAGCGACGTAGGAATGTCTAGCGTGTAGGCATCACCCATAACTCGTAGTACTTTGAATG
GCCCAATCTAGCGCGGCGCGAGTTTGCTCGCGCCTAGGTTCGTAATAGCAGAGGTACGAATTCCATCCGTTGAGAGTAATACCCGCTCATCAATCTTGAA
TGCACTTGTGTTCTTGCGGCCACGTTTGTCAGCGTTTTCCTTCTGCTTGTCAACCGCGAGTTGTAGCGCGTCACGGACGAATCGGGTAACCGATTGACGA
TGAAGGACAAAGTCGGATACGCTGCCTTGTCAGCGTGTCGCGCTGGGGGTTTCGGCGCGTAGTTAGCCACAGTCGAGTGTGGGCTGTGCTGGAGCGATCA
GCGCTCGGTGTGTCCAGTCCACTAACGGCGACGACGTGGATTGCGCGGGTGCGAGGATCTTCTTCGACTGTAAACGCGTCACCGCGTTGATGTCTACTGC
AGGAGTAGCTGAACTCGTAGACGGCAGAACCGTTGTCTCACCGGAAACCGGTGGTTGAACCAGTATCGGAACCGGTTGGGCAGGGTTATCACATTCCTCC
CCCTCCAGAGTGAATACATCAGTCGCCGTGGGTTGGCCCACAGCAAGTTGTGCGGAGACACGTGGATGACGCGCGTTGTTGACGAAAAACGGAGTCAATC
CCGTCGACGCGTGCTCGGCATCGTTGAGTGCAAACTCCGCAAGAGGCAGGAAGGAACTCCAGTTCTCGAAGGACGGGGCATAACTGCGCAGAACATCTTC
TAGCACGCGGTTGACGCGTTCCGTTTGCCCGTCAGTCTCCGGGTGCGCCGCCGTCGACATGAGGAGTTTGGTGCCCAGGAGGTCGAAGAGTTTCGTCCAG
AACGCCGATGTGAATAGGGGATCGCGGTCAGAGACGATTGATTCAGGAAGGCCGTGATGTCGGAAGACAGCGTCGACGAAGAGCACCGCGGTATCGGCCG
CGGTGATTGAGTCCGGAACCGGAACGAGATGGCACATCTTGCTAAAGCGATCCACGAAGACCAGAACACCAGTACGACCGTCAGTATCGGGTGGGAGACC
GAATATGAAGTCCATTGACACAGAGCGCCACGCCTCTGTTGCCAGAGGGAGAGAACGCAGCGGAGCTTGCGATGACGGTGACGGCTTAACGCGTTGACAA
GTTTCGCAGGAGCGGACCCACTTGCGCACCCACTTGTATAGGTGAGGCCAGTAGAAGTCGCGGGATACCGCTGCGAAAGTCTTCTCACGGCCCAAGTGGC
CACCCACTGGAGCGTCATGGAATTCGTGTATAATTCTTGCGCGTAGATCGGGGTCGTTGGGGACAACGACGCGAGGAGCATCGAATCGATCGATACTGTA
CATCAGTAGATCACCGTCAAGTTGGTATCTGTGAATCTGGTCGCGCGTGGAGCGGCTCAGTGTCTTTAGCGTGGCATCACTTGGTGTGCGAAGGTGTTCC
AGGATACCGGCATATATCGAGTCATCTCGATACACGGCAGAGATCTCTTCCCGCAGGGGAAGTATTGGAGATACCGCCGTCATCAGGTTCACACCTGCAG
CCACACATGTGGCGCAGTCCAATTCGTCGTCGTCCGCGTCTTCAAGTGACTGACGACCCAAATCTCGGCGTGGATCGTAATCGGGGCGCCGAGATAGGGC
ATCCGCAAGGATGTTATTCTTGCCTGGCTTGTGATGAACGACGAAGTTGTACTCGGAGAAGAATGACAGCCATCGTGCCATGCGCTGAGAGAGATGAGGG
CTCTTCGTCGCTGTTCGCAGCGACGCGTGATCTGTGTAGATCGCGAATGTCTGCTCACCGAGTAAGTACACTCTGAAGTTGATCAGTGCGTAGCGCATCG
CAAGGAGTTCCTTGTCGTGAACCGGATAGTTCTTCTCAGCGGGCTTCATCTGTCTGGATTGGTAGCTCACGACGCGTTCGCGACCTTCGTCGTCGAACTG
CATCAGTGCATAGCCGATGGCGAAGTCGCTCGCGTCGCAAACAACGTGGAATGGCTTTGCATCATCTGGAAGCGCCAGGATTGGGGCCTCCGCCAAGCTT
TTCTTCACTGCATTAAAGGCTGACTGATGTTCGGGAGTCCACGACCACGTGATGTCTTTCTTCAGCAATGAAGACAATGGCTGGATCAGACCAGCATAAT
TTTTCGTGTACTTGTGGAGATAATTTGCGAGGCCAAGCCACTGACGCAATTCAGTCTGATTCTGCGGCGTGGGCCACGCACAAATGGACGAGAACTTCTC
AGGATCCGCTCGGACACCATTTTTGCTCACCTAACAGCCAAGCACCGGAATCTCCGGGGCACAGAAGATGCACTTCTTCAAGTTCGCGTACAGTTTGTTT
TCGCGCATGACTTGGAACACTTGTCGTAAGTGATTTAAGTGAACTTCTGTGGCGCTGAGATCGCCCTCAGCGCGGCTGTGAACGAAGATGTCATCGAAGT
AGCTCGGAGCGAAGTCGCGAAGTGGGCGCAGAGCGTGGGAAACCATGCGATTGAACGTGGCTGGTGCGTTTTTCAGGCCCTGCGGCATGACAAGCCACTC
CCACAGCATCCCGCTGGGAGTGCTCACCGCTGTGAGCGGGACGTCGCTGAGTCGCATCAAGATCTGATAGAAGCCATCGGTCAGGTCGATGGCGCTGAAG
ATAACACTGCGGCCCATGGTGTCAGGTACCATATCCTTCCGAGGGATCGGAGTTTGTGCTGGAATAATGGCGCCGTTTAGCTTGTTAAAAGCGTGAACAA
TTCGCCAACCACCCGTGGCCTTCTTCACGCAGAACGTCGGACTCGAGTGTGGCGAGGTACTCTCCCGCACGTGACCCGCTTTGCGGCGGCTCTCGGAGAA
GTCGTCAATGGTTTTAACCTGATCGCGTGGGAGGGGCCACTGTCGCGTCACACAGTACTTGGAACCCGACGCGAGATCAATCTCATGGCGAATGCCTCTG
TCAGCAGGGAGCTCAGCTGGAATCTTGTCGGGAAAAACATCCGCGAACTCGCGGACGGTGTCGTATACTGGATTGCCCGAGTCGCGGAGTGACTCCCACG
ACTGGGCAGCGAAGCGCTCTTTGCGCGCCGACTTCGGCTCAGCGTTCTTTGGACAAAGTGGAAGATTGTCGGTAGCGACCGTGTGGATCTCTTCCGCCGA
GGCAGACTCGGTGATCAAGCAGACCTGCTCGATGTCTCCTGACTTCAGATCGCGCAGAAAATGCTTCCAGGAAAGACCCGGAAGGCGTGTGATGGAAGAA
GCTTCGCGAGGTGGGCTCTCAATGTCAAGTGTGCGTGAGCGAACGACGCCTCCTTCCACGTGTTCCAGGACGTGTATGGACTCATTCACTGCGATATCGG
CGGTGGGCTGACCACGTCGCCTAAGGCGGCGTCGCTTGGATTTCTTCTTGCGGCGTCTCGAACCGCTGCTCGAGGCAGTTGACTCGCTATCGCTGGACGA
GGGACCACCCCCCTCTAGACACGGAGGGGCACCATCAACCGTGTCGGTAGTGCGCGGGAGCTCTCGATGGTCGACCGCGCCATCGACAGGCGAGAGCCCC
TGCTCGATCGCCGTCGTAGCCGGTGGGAGTGTCAACTGCTCGACCACCGCTGTGGATGACGGGAGCTCCAACTGCTCGACCGCCGAATCGCGTTGCGGGA
ACCTCTGCTCAACCGCTAGAGTGTTTTGCGGGAACCCATGCTCAACCGCCTTGTTGTGTTGCGGGAACCCATGCTCGACCGCCGTGTTGCGTGACGGGAA
CTTATGCTCGACCGCCGTGTTGCGTGACGGGAACTCATGCTCGACCGCCTGCTCGGATTGCGGGAGCCCCTGCTCTACCGCCAAAGTGTTAACAACCTCG
CTTCGCAGCGAGGGATTTTCGCGCAACAGCGCTGTGCAAGACATACAGAGAGGGCCATCGCTCGCTCTCTGCTCAACCTGCATTGTGGACAACCGGTCCA
CGACCCTGACATGGGGCCAGTCCTTCTGGGCAACCAGGAGGTGTGTGAACACCTCACTCACATCGAAGCCAGAGCGGTGTTTAACCGACCGAGCCAACCA
GTCAATCTCTGGTTGATATCGTGACAACCACGGGATACCCAAGATGCAGTCGAACGCGTAGTTCATCTCAATCACGAGGAAGTCGTCGTTGCTGCGGAAG
CCGTCGAATGTGTACGGCAACGTGATCTCGCGCCGCGCAACGCGGCGTGGCTTTCCGTCAGCAAGTTTGACGACGACCTGACCTCGACCATTACGGACTG
CGACCTCTCTTGGAAGCATCGATAAGCACGATTCACGAAAGAAGTTATTCGACGCTCCTGAGTCCAGGAGTGCGCGAAGTGGTCGCCGAGCGCCGGCGGA
AGACTGACGATGATCAGCCTCGAGTCGCCCGACGCGGCGGAGGTGGGGGGGGGCATATAGTGTGTGCGTGGGAGACAGGAGAGGCTAAAAGTTGGGGTAG
CCTCCGGGGGAACCCGAACCTCCATTCCAGCCATTAGGCGCCCGCACCTACTCGCCTGGCCCGTTTTTTTGACTGAAACGCAGGTGAGACTTCGGCGGTG
TGCGCGAGTACCAGCGCTGGCGCGCGGCATTCTGCCGCGCGATGACCGATCTTCCGGCAGCGGAAGCAAGTGATCGGGCGATTAGGACGGCCGTTGGGCC
CACGAGAAGTCGACTGACGGTGACTATTCGACGCGTCAATCGCGTCGATCTCCATGGGCTCGGGGGCTGACTCACGACCTGCCGTAGACATCACGCGCGC
GTAAGACGCCGCCACAACGTAGTCTTCGCGTAATGCGAGGGCGAATGCTTCCTCGAGAGAGGAAGGTTCCGCTCGGGTCAGGCAGTACTGAGTCATGCCT
TCACGCATGCCGAATACGAATACATGGACCGGCGATGCTGTGTCAATCGGATTTGTCACGATGCATGACGCGAGGTGGCGAGTCTTTTGAACGTAGTCGC
GCATAGTCATTTTACCTTGACAAGGGCGAAGAACTCGGCACGCACGCGGGATTCGTCTTGTGGCGGCTCGAACGCGAGCCTGAGATCTTTCTGGAGAGAC
TCCAGAGTGGGGAATGCGTCGTGATCAACGACAAGTTTGCCGAGGGCCCATTCCTTGGCCTTCCCGAACAACCGGGACAATAAGAAATTCACCTTTGTCC
CTTGCGCTTCGATCATTCTCGAAGCAATCGCGATGTCGATCTCGCGAAACCACCGGTTCAGCGGGAGGCGATTCGCTCCTTCACCGGAGAAGGTAGACGT
CTCTAGCTTCACGACATCATTTTTCGAGGAACGCGCGGGAGTTGTTGCTCGCCGATTCGCATCGGCTAGCTCGCGTTCCATGAACTCTTGGGCTGCTTGG
CGTTGTTGGTCAGACGTCGCTGAGCTCAGCAGCGACGCGATTACAGCCTCACCAGACACCGCCGCGAGGCGGTGAAGGGCTTTACACTCACCACGAGTGA
GATAAGGGAAAGCAGCATGTTCCAGGGTCGGCCCTGGCGTTTCAGACGTCATGCCTTGGCTCATTGTGAACTTGGTCATGGGAAGGACTACTAAGTGCTA
CCAGGTGTAACGGGCCTGGGGTGTCCGTTACTTGCTTACACGTAGTGATGAGGAAGCGTACAAGT