Description :
From Genome Similarity Track
Location :
Scaffold_300:16126- 19051
Sequence
2925 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNCAAGGTACCCACGCCACCAAGAACCCAGCGTTTGGCTTCGCGGTGAATTCCTGGACATTTGTTGACTCCTCCTACTCTCC
CCCCTTCAATCGTGGAGGTGGAGTTCCTGGAACGCCCTATATGAACCTCCCTGGGCGGTCAAGGTTTCATCGATCTCGCCACACTTACGTTGTAAAGGGT
CTGCTTAGACCCACTACTATAGCTTACACGTGTGCGCACGTGTATAAGGAAGCGTAGGAGTATTTAAGTTAAGTTCAGTATACTTGTATCCGCAAGTATA
CTTAAACTAAGACAAAGGGACCGAACGATAGCTTTGGTGCTAAATGAGAACTGTATTGATTGTAAATGGGGTTTTCTCCTAAAACTGATATTTCTAATGA
GAGGTTCTGCCATTGGATGGATGGCAGAACCCCTATCTATTGAATGACTCTCATTGGTAGAAAGGCGTTACTTTCTACCAGTCATATGCTTTTGCTATGA
ATGTGGACCACCCTGTGGAGTGGTCACCTGAATGTATTCCTTAGTGCATGTTGTACTAAGGTGAGAGGTGAACCGACTGTGTAGGCCCGCTACATACATC
CTCTGGCGCCGATACAGTCTAGGCCTGTATGGCGCCATGACCAGGAGCGGTGGGTTCTACTGGCGTTGCAACTCCCCTCACTGGACTATACGTCCTGTTC
TCTATTATTGCTTGTGGCGGTCCATTGCCCACAGTGGGCGGTGTCTCATCACCTGTTGCAGCTTCTGCTACAACTACTTCGACGGAGTTGCCGATCACGG
CGGCAACTACCTTAAATCGGCGGACGTCATTGCGTCCAGGTAATCCTTTAGGATACCGTGTGTTCTGGCAGAGGTGGGATCATTACTCACCAATGCTCTG
CCAGAAGCTGAGTGCCGGTCAGCCTTGATGGCTGTACGGCACCAATTGCCTCAGGGTGCATACGTGCGCACCCAAGCGGATGACGTACGTGTCCACGCCC
GCGTACGGCTCACAGCTGTTCAGGTAAGTGAACCTGACAGCAAGGTATATGCAGACCATTGCCTATGCTTTCCCACAGAGAGGTGACAATCGATCCGGTG
GCGTACGAAATTATTAGACGCTCCTGAAACTAAATCTTCCTAGGGATATTAACATCCCCGTACACTCACGTCTACTACCTGCAACACAGCGTTGCCCATC
ACCGATTTGAGACATAAAGTCTCTCGTAGACTAAGCCTTCATGGTGTGCGCCACCCGCACACCCGTCACGGAGACTCAACTCTCCCCCGTCTGGGGAACC
CGTGTGGCGAAGCGATCAGTCAATTTGGCGGTCACGACCGATCAATCATGAAAGGATGGGATTGGGACCGGAGATGGGTGGATCTGGCCGTGGGACAATA
AGTCCGAAAATCCAGATGACCATCACTTTCACATGGGACCATCACTCTTCACCGAATGATCGACATGGGTACACGCGATCACACAGGACATGGCTACAGA
ATAGATGATCGACATGGGTACAGGCGATCACTCGGACGATCGCCGAGGAAATGGGTACAGATCGGCTGATCATTTGGGAAGGTACCACTGAAAGGGTACA
CAGGAGGTATAGGATGGGTTGTGGATCGTAGGATAGGAATCAGGATGGGGAGTGGGTACTTAGTTCTTAAGGGATAAACAGACCAGAATTTTCCTTGCAA
GACACAAGTGGCCAGCGGAATTCCAGGGAAGGAAGTATATTGGCCTACCCGACGACCCGACAACCCATATAGTGAAATCAAGTGTAAACGTGGAAGCCCC
TAGATCGCTTGGCTAGGCGCGCTCTCCCTTCTGTCTCAACTCATCAAGACCCCGCCATAGGAGGCGGCAAGCAACGTAAAGGACCCCGCAAAGGAAAACA
ACCCCCCGTGATCGATCCCACACACGATCGACACCTGATACCGACCGACTGCGTGAAGCATATCCGCGTAGTTGTCAAACCCCCCATCCCCTGAAGAGCC
CATCAAGCTCAAACCCCGATCTCGA