Description :
From Genome Similarity Track
Location :
Scaffold_239:16126- 18428
Sequence
2302 bases(100 bases per row)
AGCCTGAACAAATCTCTTCCGAGATGCTGAGTGACGTGAGCGATCACGACAGATGCATGGGTGGGTACTATCCTAGGTGCAGCTGTGCGCGCTAAAATTT
ATTGTACGTATGGAAGGTGTCATGCTGACAGAAAGCGATACGTAGAGTACATTGCTTGTGCCACTTGCTGCAGTGAAAGTCGCTTAAAGACTGTGAGGCG
TAGACTTCTCGTAGCATCGAGAGTGCACGGAACAGATCCATTATTTGCTAAATGCACCGGGCAAGCAAATGACGATCGACGAGCAACGAGAAAAAAGCTT
TTTATTGCGCGCCTGAAGGGTGAAGCTATTAGTGACTGAGCGCAAGGTACGTGAATATACAGAATTTGATCCAGTTCTATGGACTATATTACTTCTCCAT
CAAAGAGCGAACTACAAAGATTGCTCCTCCATCTGATATTAAGGCGCGTGTGAATCGGCAGCGGGACGACAGTGTACACGTGTCGGCAAACGTTAGTCAG
CAGAAGCACCGGTGTAACGCAAGAGCTGAACAAGGACGATAGCATAATAGCAAGAGCTTGATAAAGATTAAGTCGTTTTTAGTGGCTTACATAGACACGA
TGAGACAAGCCGGTAATCGGTGTGCGCATGGCGCTCAGTTGGCTCACGCGGTAAAAGCATTCTTATTCTGGAACAGGTATACTACATCTATGAAAGGAAG
TCTTACAGGAAAAAAAGCTAAAAAATACCGCTTCCACCACGCGGTTTTGCTATTTCTACGATAGTAGAAAGAGGCCTGGCTTTAGTACATTTTTGATAGG
TATACTTATTTCAAGCTACACGTTTTGGCGATTTTCACTACACCATCTACCGCGCTAACCGTTACCAAAGAAGTACACAACTGCTTAAGTAACAAAGACA
CTTACACCAATATGATCTTCGGCCCTAATGCTGCTGGTAGCCTCGTCAGACAATTAGATTTAATCACAAGTCGATGCCATGAAGTGATCGGGTGTTGTCG
AATCGATATAAACTTCAGATGCCAAGTGTCGTGATTTTGGCGCCCTGAGTCACTCGAGGACGTCTGCTTGTGTTCAGCATAGCCGGAAGCAACACTATAT
CAAGCTATATGTGATGCATTCCACTAAACCATAGCTCAAGCCACTTCGCATCCTCGTTGTGGGTGATCTTCGCCGGTGGTAAATCTTTATGCNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTATATGTGATGCATCACTA
AACCATAGCTCAAGCACTTCGCATCTCGTGTGGGTGATCTCGCCGGTGGTAAATCTTTATGCAAATACGCTTCAGAGCGGCGTTTGATAACTGCTCGTAG
GATAAGCGGTTTCACATCTCGATAATGGTCTCTTGACTCTTGTGCGAGAGATTCATTCTGGAAGTACCAGAGTGCCGATACCACGACACAGTCCACAATG
AACGGCAGTATACTTCGTTCAGCTCCATTTAGTGCTTCAGTACGTATTTCACGCGTTAGCAGCATCAGCAAAAGCGTCTGCCACTATGTTACTAAAGGGA
CCCGGATGCCTTGTCTTGTACAATCAAAAGTCATGAAGCCCCACATGATCATCTCACGCTTCGGCTCCAGAAACTTTTACAGACTTAGCGCATTTCGGTA
ATCCAGCTGCGTTATCACAATTTGCTGGAATTGTATAGCTGCTGTAGATGATGGCAACTTGGCAAGTCCGTGCACTAAACACGATACCGTTAAGATCATC
CGCCAGTGACGAGCTGTCGTCAAAGCACGCTCAAAGACGCTGGACCGAAGTAACGCCATCGATATCGTTGCATTCAGCCAGCATGCCTACCCTATCGCGG
CG