Description :
From Genome Similarity Track
Location :
Scaffold_77:161220- 169070
Transcript NameFunction/comments
Hyaar_Emoy2808263DNA excision repair ERCC8like protein putative
Hyaar_Emoy2808264DNA excision repair ERCC8like protein putative
Hyaar_Emoy2808265FKBPtype peptidylprolyl cistrans isomerase putative
Hyaar_Emoy2808266hypothetical protein

Sequence
7850 bases(100 bases per row)
GGAAACCTCCACCCGTTGATTTGTATCCTGAAATACCAGAAGATGTCAGTGGTGATGTGCAAACGATAAGTGGTGGACCAACTGCCGATGCTAGTGCTGG
GATTGGCGATACTGATGCATGGAGCGACGATGAACAAGAAGAGACAAACCATCGATTTATCCCACCCATTCTGCGCGATAACATATAGAGCTGCACGGCA
TACAGGGCTGAAGGACTGCACGATCTTTGGCAACAATATCATGATGTAATTGTACCAGGGGTCGTACCAATAGAATTCTAGAGTTACATAGATCGACTGA
TACTGCGACCTGGTGGTTGTTCACATGTAGATAAAATTCCTAGGTCTTTCCAATGCCGCGTCATTGCTAGGCGCAACCGGCCTCCAGATACGATGTTTGT
AATTAGGAGAGCCCAAACTGACAGCTCTCCCTGCCCGCAACGAACAGTTGTTTTTCAATAAACCTGCAAGAGCCAAGCTAAAGAGTATGCAACAAAAAGG
TGATACACAAGCCACATGCGAGTCTTGAGCCCTCCAAGTCTGAACCACGACTACAAATTTGACGGCCATAATCATGTACGAGTTAATAGCAGGTCGTAGA
CCTCGACACTCAGATGCAAGAACAGTTACCAACACTTCAGTAGCAGCCTGTGTAATAACCAAAACGGAAGTATTAGACGTCGGTGAACCGTTCCTTCCAA
TAATTACATAGCACAACTGCACGAGTTTCTTGCGAAGCCGTGCCACAATAGTAACGCTCATCAGCGCAACAAACGTGGACGCGCACTGGACGCGCGAGTG
GGAGAGGAATACTACGAGGTCTACAAAAATCTTTAACGTTACGCCCAATTCATTCAAGGGGCGTCGGGAACGACGCCATTGTACATAAGATATTATAAAA
AAACTCTACCACCTCTCATCATGATGCCATATTTGGTCAATTACGACATTTGGCATCGACGGTATGTGTGCACGATAAGAGTCAGCCTCTGATCTTCGAA
GCGCTTGTTCAAGTTTATAGAAGATTGGATTCTCCTACGTGGGACCTCGGCTGATTCTGTGATCAGCAAAAACGCATCAGAAGTTGCCACACTCCAGTCA
TAGCAGCATCTCATCTAGACATAAGTTGTGGGATGTAATCTTTGCTCATATCCAGTGTATGCTTCTGCACAACCAGTCTTCTGCTAATCTCGGGATTAAG
TCGAATCAGTTTACACCAAACCAATGAGCAATAGCGATTCCATTTCTCTATTGGGTCCTGTCTTTTGTTTTGCTAAACCCTTTCGATCGCGATGTGATCT
TGTGAATGTCTAAACCGATGTTTGGGTGCAACAGAGGTCTTGCAGGTTTCCCAAATTTACTCATATATCCTCGCTCTGTAGGAGGTACGAAATGGAGCGA
GTACTTGGTCGGTCAGCCACGAGCCCGAGTCGTGATGTGAAGCTAGACCTTTTGGACGGCACCTGAACTGATCGCATAGCCCTATCTTACTCTTAGTCGT
AGCAATATCAGTGCCGACCAGCTTATCTGTAAGTCGCTTTGGATGTAAAATACGTGGTTACGTGAACACGAAGACGAGATTACAAACATGACTGCGCTCT
GCTAAATAATTGCATCGGCCGGACGAACAAGACCTTCACATGTTCATGCAACTTATATAAGAGCTCAATTACAATACATGATACCCGTGGACCCAGATTG
AGTTACTACTTTGCCTGTTAAGCTATAAACTTGCAGAAATACCGATTAGCTGATGTGTACCGCTTCTAAATTGCCATACGGTGTCGACAAGCGTCTACTC
TTGAAGGCGAACAACGTGGACGTAGAAAAATGATCTGCGGTAAATGTATGCAACGACTTCAGTGGACATCTAGAATGAATAGCTGCACTGTCTAGCATGT
TCAGCTAACCCCAACTTAAACCATCACCGATCATCAATCTAGAGCAAAAAGTCACTTCAACGAACTAGGTCTTGTCAGCTTGGATACAAAATGACTCGCC
TTTGATCTTTTGTCCAACGACTTGACGCGATTCTACCAATCACTATCCACGGGAGGCGATCTAGGTTGTATGAGGATCGATTGTATAGCATCTACGGTGT
TTGAATAGTACTGGCAAAATATAATCTACACGCCGCTGTCAAGTATTACATCAGGTCATTGGGCTTCGTTTGCTAATTGTTGCTGCCTATGCCTTACCGA
CCAATCTAATTCTTTAAGACACATGATTACAAAGCACGTTCAAACTTCACGTCGGACGACAATCCCGTGCTTACCGCTTTGAGTACCAGGTGAAGCCTTT
AACGTCAAGTGTCGGTGGCTTACCCACGAATCTTGCATCTACTATTGTGTACATTCCGTCTACTTGTTCTTGAGGGTATGTGTAAAACTTTCGAAGAAGG
GACACGTAGCTAAATGCTCAGATCTTCTTTCCAGTACATATCGTTCGAAAGCATTGTCTACCTTTCTGTCGGTGTCTTCGTGCGGCAATAAGAGCAGGAT
GATAAGGCTTCCGATCTGCTATTAATTGGACACCGCTCTGTTTTTTAACTGTTATCACATTGCCGATAATCGCTCTATTTAATTTATAGAGACCGTTTAG
TTTTTGGCTCATCGCTAATAGGGCTCCGTCCCGCGCAGGACGGGAGGGACGGAGGAAACAGGGGGCGGGATGGTTGAACATTTTGCCCTACGCATAATTT
GAAACGACCAAATCTGTCGACACATGAGCGCCTCCGTATGCGCTGAGGGTACCGAAGAACGAGACTGATAGTGGAACTGTTTAATAATTTGCTATATGAT
CAGTGTTTATATAAGACTTAACACAACAAGAATGTCGCCCACGCAAATTACCAACTTGTTTTAAAGAAGAGATATCTTAGACTACTTTACAAAGCGCACC
TAGCATGCATGCAGGTCCCACTTCTGCGTCCCCTGATTCCAACCTATACATATACATGTATAGCGAGCTAATTGAAGCCTACTCCAACAGTTTACCGTCT
GCAACAAGTGTAGAAGCTGAATGCCTATTCCACTAGATCATAATGGTGCCGCAGATGGCATACTCATGCAAGAAGTGCTCTTCATTATTGTTGCGGTGAC
AGAATTGCGAAGATTGACCACACGCATCAACATCAATGCAGTAGAGTTCCAGCGAGTAGCGAGGTCTTGACATATGGTCTTGGAGAAAACTTTAAGCCTT
GCGATCGCTCGACAGCGATCCTGGCGTTTGGTGGAATAGTAAAATCAATTGACGATACTTTTGAGCAATTGAGTTACTGCCAAAAGAAACTCATCTTCCC
AGATATTGATGTCGTGATCCTTTAAAAGGCTAAAGAGGTCCATCGAATCGTCGCTGGGGACAACCAAATCATTTTTACAAGCATCTTTAAGTGCCTTTAA
TGCATGGCTTGGCAGAAAGATCAAATAATGTCAATCAATACTATTGAAAATGGATACATATAAATAGATAACGCTTGCAATTTACGCTCTCTTACTTACC
AAATGATTATATGAGTAGAAAATTAGTAGAATCTTGATGTTGTATAGTAAGAAAATTATAGTGCGGGAAGGTAACGGCTCATCCCGCATCCTATCTCGCG
GGGGATGGGATGAGGGATGAGACGTTACGGGATGAGACGTTGCGGGACGGAGCCCTACTCCCCAACCTAAAATTTATCGAGGTAAACTACTGCGGCATAT
GACAATCGTCTTCATGCACTGCCAATGCAAGTTAGAAAATGTAGAGGCTCCTTACTTATTCAGACTACAAAAACGAAGTATCGTGTACTATGCACATGAA
ATCCTGGTACGGCAAAAATACTTCTACTGCCAAAAGACACTGCAAATTCGACAGATCCAAGCTACATTTGTGTAAGACAATACAGTAACGATCATTCCAT
TTCGATAAAGGTAATACTATTCTCGATCAAACTCGATTTCCGACCGCATTACGGGGTCGATAGCAGCACTTGAGTTTGGTGTGATACGTCCGTCGAGCAG
TAAGTCGTATATAAGTGCGCATAGTCTGATAAATAGATCTCGACACATAATTTCTTCGGTGACAAAAACGAGTCAATAGACGCATCAGCGTCGTCACCGA
GACTCGAGCTCAACGTCGGGATAACTCAGATGCAATTGCGTGTATGTATGCATCCGCGAGTCTAAACTGATATGATTTTTATACGAGTTTTTGAATCAAG
TGACGAAGTAGGACATTCATCAGACCAGAACGGAACTTAGTTGACCTTATCTTGTTTTAACGTCGCTAAGCACGAAAAACTGACCTGAGTAAGCTGTAGA
TTCCTATTTGAAGGCATTCTCACTCGCGTTCAATGGTTTTCTATGATGGTCAATTTGCAATCATGAAGGCTCTACACATCTAAACACACTAAATGCACTT
GATCGAGTGATGGCATACACACATTCCGTTGCGTTCCTGCTGACTGCAAGATCCCTGACATTGTTTGTACCTGAGACGAATTACGACAGGCTGCCGATCA
GCACGGACCCAGGGAGGCGTCAGGATACTACACAACGAACTGGTCCGCCTCTTTATTGGTACTGACATCGTCGTTGCCGCCAGTGTCGAAGTCTGACTTC
CCAACATAAGTGAACATGATGACCGCAACGAGAGCGATCACCACTGCAGCGATAATCAGTGGATTCTGCCTGGCACGTGCCACCAGCGCCGCAATTTTAC
GCGTCTCTGCATTTCGCGTAGCTTTGCTGCCTCCCAACTTGGCATACAGCTTTCTCTCTAATGCCTTCTGATCGCGTTTGTTCGTCTTGAGCTGCACCAG
CAGTTGACGCACTTTACCATTCCTTGGTTCGATTTCCACTGCCTTGCGCAAGAACAGGTTTGCTTCCTCAAACTCGTTCTGGTCCAGCGCTATTTGACTA
ATACGGTACATGGCCTTTACGTTCTTTCCGTCTAGCTGCAGCACCTCCAAGCTCGACTGTCGCGCTTCCTTGTACTGCTTCAACTTGTGTTGCACGTTGC
CCACATTGTTTCCCAGCGCTACCAGTAACTCTTTGCACTGCGCTGCATCCTCCTCCGAGTGCTCCCACGACTCGAGCAACTTCAGTGCTCGCTTATACAT
CTTAGCTGCCTGCTCATAGTTTTTCTCCTTAAAGTAGCGGTTCCCACTCTCTTTCTTCTGCGTCGCTTCAACAATCAGCTCCTGCGAACCCATCTCAGCC
GTGATCTTTTTACCAACGCGACAGAGCTCTACTACAAACTTCATCTCTGCGCCAGGAGCCACATGCGGGTCCAGCCCCACGTCTCCATAGGCAAATCTGG
CGTCGCAACGCACCTCACACACTTCTCCTACGTGCATCATCTTGGCCACCAGCTCCAGTGCTATGCCAAGTAATCAGCATTATACAACCAAGTTAGTTAC
TGGAGAAACACCAATCAAATATACTTTTTTGGCAGAAATGACGTGCGTACCGGGCATCACCTCGCCATCTCCGATCCGAAATTTTCGAACCTCATTTAGC
GCGACCTTTTGGTTCGATTTGAGTACCCACGTTGAGTATTTGATACCCACTTCCTCACCAAATTCTGGTTAAAAACAAAAATACAACGACATCATAAGAA
ATAAACGAGCTCCACGTGGCGAGTATTCTTCTTAGGGGGTACAATAGAAACGGATCATGAACCTAGTCCGAACCAAAACGGGTTTGTACCTGCTTGAATA
CCGTCAGCATTCACGGTTAACATCTTGCGAAAGATGCCGCCGCTACCCAAGACATCGTAGAAATCTTCACGTTCGGACTCACTGATAATCACCATGTTGC
AAGGTGATAAATGCCTCAATTTACAATTTGAGTCCAGCTTTAAGGCATGGCCAAAATTTACTATTTGTAAGCTGTATTTCGTGACAGTGTGTCTATTTTG
ATCATACGTTGCAGCGGCTATTTCGGGTATCCACTTAGAAATGAACCTGCATCTCTTTCTAATTACGTCAGGTTGTAGCAGTATCGTCAAGCTCACGATT
GCCTATAACGCTTCAGCTTTGATTCGCGAAGTAATGAGGGACGCAATAGTGGGGATCTGATAAAACGGCCGAACCGCGTCGTAAGGAAAAAAGGTACCAC
CGGAACATTAGCAATATCGGTATGACTCATTTTGCATGTTCAATGTCGAATACGTTCGCGCCGACAAAGGTATGAGCTTGAACGGTTTGTAATAGCCTTT
CAAACTGAGCATTTCCATTTAGATGCATCCGAAGCGAGGATAAACCAGCAGCATAGCTGAAAAAAGTGGCCTCTGTATCCAGTAGTCATATCACTTGAGC
GGAATAGATAATCAGATAGCGAGCCCATGTTCGACTGCCAGTGCCACCAGCAGCTCACGGACATCCACTGCACCTGACAAATATCAATGCGGTCAGCCTC
CGTATCGCCGATGGCATCAAAATACACGATTGACTTGCTCACACTGGTTCTTGTCATACAGCCATCACTCGTCACTAGGCAACAGGAGCTGAAAACTATG
CCATGCGCACCAATGAAGAGTGCGACGTCTGTTATCCACAAGAGTGAAGCGGCACATCCAGCGTGGTATACCCCTTCGTGATGGTATGGACGAAATAGCT
TGCTGCTCCAACTGTCTAGTGTTTGCACGCGATCCAGCGTTGAACGACAGCTACTAAAAGTAGTGTGTGAGCCATATCGGAGATACCGAGTAAAGTGTTA
CTTTCTGGTGATCGAGACTTCGAGCTGAGAGGTCAAGAACCCTTCACCTCCTTGTCAGTGATCGTCGAAACGCGGCAATGCCATCCTGAAGCTCTTCATC
CTCGTCCTCCTCATCGTCATCGCCATCTTCATCATCGGACGAGACAGCTGGAAAACTAGTCGATGGAGAGGTAGGAGCACAATCGACAATGCCACCACGA
GCGTCCGGCTGTAGACGATGAAGACGGGATGCGAGCGTGCTGTTGACTTTCTTGACTGCATCGACTTGGTCCCTAGCTTCACTCAAAGATTCTTTCAGCT
GCTGCACTGTACGCAGCAGCACCTTGTTCCGAGCTACGAGACGTTTGCCACCTTTGACCTTGTCACCAGCGCTGTCAAATTGACGTTTGAGCTCTGCCAA
CTCTTGAGCTGTTTCTGCAGCATCAGCCTTGATTGAGGCAAGCTCAACCTGCAGGCGGCTTCGCTCCGCCAATTTTGCCACAAGATCATCCAGTGGTCGG
CTGTCATTGGCCTCAACAAGTTTTCGGACCTCCCTCGACAGCTCTGTCGATTTTGCACGAAGCATGTTCCGTTCGGCCACCAAATTAACGTACTTTTCCT
CTAACTGAGCGATTTGCGCCTGTTGGTCCTCAACGTGTCGCTGAAGATCGGTAGTACTTACCGTTACGACAGTCCCAGACCAGGCATCGCGATTCCAGCT
TGGTACAGACCACAGATCGGTATCTATCAGCCCTTTTCCAGTGATAAACTGGGCCTCAGTTTGAGTATCCTGGTCAAGCGTCCTTAACGAGTGCTTTGCT
GTCACTCCGGCCAGTTGCTCCAGCTCTTCTCTGCAAGATGCAAGCTGCCTCTCTTCAGCCTCGAGTTTTGAACGCAATATTTGTATTTCGCGTGCTTTCG
CATCGTGTTGTCTTGCGAGTTTCTCAAGTTGCCGAATCTTCGTTTGTTGCAACTCGATGCGGTTGTTCTTCATCTCGATGGCTGCAGCAACTTGCTTGTT
CTCCTGCATCGCCACGTTGTGAAGAACCGAAACCGACACAAGCTTCTCTCGAAGCGTAGATATCTCCTTTTCTTGGGCAGCAAGACGACCCTCCAAAAAT
GAATTATCGACACCAACATCGTTGCTGCTCACTCCAAGTCCATTTTTGCT