Description :
From Genome Similarity Track
Location :
Scaffold_283:16121- 18736
Sequence
2615 bases(100 bases per row)
GTCATCGCGATTATTGCTCCGGGCTCATCACGGAGGCCAATTTTCGGGCACTTCTGAGGGCCCATCCATGGAGTGTGTTTGAGAATTCAGAAGATCCTCG
TTCTTTCGAGATGAATGTGGGCGGCCGACTCAAAATCCTGATTCGCGAATACAGTGGCTTCGACGACACCCACTTGATGGCCTTTTGGGAGTCGACACAC
CACTTTCCGATGCCGGACGCGATGGCCAGGAAGCATCCGTGGCTGTTGGTATTTCAGAAGGAACGCAGTAATTGTCGCTCATATGCTGGTCAAGCTTGGA
AACAGTTTCTCGAGCTACTGATCACCGTCCTGCGGGAAGGGTGGTGCGACTTGGAGATCCTGCTGGATCCCCATTTCCTGCACTTACCCAAGCGCGTGGA
GTCCGTCACGTGGTACCCCGGGATGGCCTCTCACCAGGCCAACTTGGCAGATCCCAACCTGAATCGTCGAGAGCCGGCGGATCTCCTCGAGGCACTGGTT
GAGTGCAACCGCCAAGATCCATGGCGCAATCACTATCGCGACACTCCCCAGTATCATCCGTCGCGCAACATCGCGCGCCTCCCTACCAAGTTCTTCAATA
TTCGTGCTGTCGGCGATCAGTAAGAGTTGGATCCAGAGCGTCTACTTTCAAGCACGTCCAAGTTCAGATATCTCTACAGCTGAGCAAGGTTTATACGGAC
ACTGGATCTGCCCCTGCATGCCGAGATAAGTGGTAATACACTCAACTTGTCGTCGTTAATCTCCATCTTGCCAGTTCTGCTTCCCTCCCAATCCACCTTT
CCGAAGCCCCTCGGTCGCCTCGTGTTGAGGCGGCCACGTCCTTCTCTCGTGGTCTTGATCCCCATGCGCACTTCGATCCAGATCCAGACTCTCGCTGGAA
TCCAGATCCAAACTCACACCCCGATCAAGATCCAAACTCTTCTTACCTTGTTCAGACGTTACGCTTGATCAGCCTGATTCTCACATGTACATATGCAGAG
TTCCCAATCCACCCATCTGCAACCACCTTGCAGATTCGTCGTCAAAATCCTCCACAGAGCGACCAACTCGCTCTTGGGGATCTCAGTCTCAACCTCCTCG
TGAAACTACATTACCCCAAACCGGTTCCGGTTGGAGCGCCCCCGCAAAAACTCATGCAGTATGGCTCCACAGTTCAGATCCGCCTTGTCCACCCAGGATG
GATCTTCATATCCACGCCAGTGTACCAGGAATTCACGGTGGATCCGGCCGTAACGAGTACGCTTTCCAGTCCAGATGTCAGTAATTTTCTCCACCTCGTA
CTCGTTTTCATCCAGATCCTGGATCCAACTGTCCTCTGGCAGCAGTGCTTCATCAAAATCAAATCGATCTGTAGTGCCTTCAGTCAACTGGATCTGGGGT
CGATCCAGAAAACTCCTCGCAAGCTTCAATTTGGACACATGCATCACATGGAACAGCCGATACTCTGTGCCTGGAGTCTCGATCCGCACAGCGTGTTCTC
CGATCTTCTCCGCTATACGGAATGGTCCGTGCCACATATGGGCCAATTTGCGAGCATACCCTTCCTTCACCCGGTCCAGATACAGCCAGACCCTGGATCC
TACCTCAATCTGGTGCGGATGGATCTCTTCGTTGTGCCGGTCTGCCCGATCTGAGATCGCCCCCTGCAGTCGCGTGTTGACTTCTGCCCGTGCCTGCTCA
TAATAGCGTTGGATCCGGTATCTCCACCGCCGTGGATCCCGATCCTGGCGGCGAGTACTGCCTACCGGGATTGTGGCTTCGAGTGTGGATCTCGGATCCC
AGCCATGTACCAAGTAAAATGGCGTTTCTCCTCGGATCCGATCTTGGGCAATGTTAAGTGCGAAGGTGAGACGCTCCGCGTAATCGTCCCAATCGCGCTG
ATCCAGATCGTGCACATACATCTTCAGAGCGCGAGTTGCTGTTTGCATGATGCGTTCGGCGGTTCCATTCGCTTGCGGCCAATATGCCATCGTTGCACGT
TTTCGTTGACCCAGGATCCGGTTGAAGGATCGAAAGAAGTCCGACATGAACCCCGGCTCACGGTCGTGCCGGATCACTTCGCTGGCACCGAATCGTCTGA
AAACACACTCTTCGTAGGACTCCGCGATTGTCCGCGCTGTTCTGGAGTTACTGGCCTTCGCGATCACGTATCCCGTGAACAGATCGACCCAGATCAACAG
CTCCGTATTACCCTTGTACGACTTGGGCGAAGGTATGTGATCCATCGCTATGATCTGGAACGGGTATGTCGCCTGGATGTTTCCCGGCGACTCGCCCCTG
ATCGTGGGTCGTCCTTTGCCGGTCTCGCAGTTGGCACATTCGCCGACGTACTTCTGCACACTTCTGAAGAGACCTCTCCAGTGAAAGTGATCGCGGATCC
GCTGGTATGTACGCCCGATCCCTTGGTGTCCACCTTCCAGAGTGGAGTGATAGTGATGCAAGATGTCTTGATGCAGCGTCTCCGGCGGTGCCACCAGTCT
CATCAGTCCATCTCGATCTGCATCCGATCGCTTGGAGGGTGGGCAATAGAACAGCAGATTATCACCGTCGATCTCGTAGTCCGCTGCGAGGTTGCCATAG
GATCGGGCCTCATCC