Description :
From Genome Similarity Track
Location :
Scaffold_24:161202- 166457
Transcript NameFunction/comments
g4791.t1OWZ17411.1 Callose synthase [Phytophthora megakarya

Sequence
5255 bases(100 bases per row)
AGCCGTGGATGAAGCCACCCAGCAAACCAAGCAGGATGACCAACGAAGCCGCCACCTCCGAGCCAGAGCTCAGTGCACGCGAGAAGCCTCCGTTGTACAT
GGCACGTGTCTGGAGGATACGCATGAACGGCAGCAGCGACAGCAGGAACAGCGGGATAACCAGGAACAGGCCGACAATCATGTCCATGAGGAAGCCGAGC
GCCATGATGGGGCTCCACATAGCCACTTCCATTCCGAAAGCACCGTTGAACGCCATGGCGTACTGTACGACCGAGTTGAAGCCCAAGAACATCGAAATGG
AGAACGTGAAGCACTTCTGCACAGACCAACCGCCCATGGCCCCAATAATCAGCGGCACCAGAAGGATGCCTCCAATGACGCAGATCATGTACAAGATTCC
TTGGATCGCGAGCGAATTCAGCTTGCGGTGCTTCGAGACGCAGTGGTGCACGCGGTTTCCGAACCAGAGCAGCACCCACGTAGCACCCATCGCGCCGAAC
AGCAGTGCAAGCCACGGGAGTGTAAACTCCGTCAGGAAGACGTAGTACATAGCCAACGGGTGACGCAGCTCACGAATGCAATACGTAAGCCGGCCCATTC
CACCCAGAGGCACCATTAAGTCCACGTCCGACTTCCACCAATCGTCCCATCCATCCTTCGGCTGCAAAGCAGCACTGCTTGCGTCCTTGCTAGTGTGTTC
GTCGGTTCCGTCTTCCTTGTGGCGCGATCGCATCATCCACGCGAACCAGTTGGCGATATCCACCCTGGACTTTTGGAGAACCAGGCCATCCGTGTTGAAA
ACGAAGGGTGCCATCAACCAACACGCACCCAGGAACAACACAGCAAATGAGGCAATTCCGTAGCTCTGAGACGTGGTGCTGAAAGCTGCAAGCGACGTGA
TGTTGGCAGGGATCAAGTCCGGGTCGGTATCGCAATCGAAGTCCGCTGTCGCGCAGTACTCGTCACGCGCATCAGATCCGATGTTGAACGAGCCGTAGAT
TCCGAATAAAATCATCACACCGATTAGCTCGACAGCCTTGCGGAAGTGGGAAACACCATACTCCTTGAAGAAGTTCACCATCGGGTCACGCGTGATCGAA
AACCCACGGCCAGTACCTCGATACTTCGAACCACCGCGAATAAGTGCCACGTCGTAGAAGTGAGCCTTCGTGCCCGTCAAGAAGACGTAAAACACAATGC
CGAGAGTCGAAACCAACTCAATCACCTTCAGGGAGGCTTGTTTGAAGCCAAACTCAACAAACAGAGTCGCGAATAGAGGAAGCGTGGTCAGCATGCCGAA
CTGGAGCAGATACTGCGTCGTCATCACACTAGCAAGCGAGTCGAGACTGCCCGTTTTCATGATAGCCGTGATCTCCACCTCAGAGTGTGTTGCAACGTAC
AGCTTGCAGTACGCGTACACGTACACGCATAACACCGTGAGGGCATTGCAGATGTAGAAACCAAAGTGACCGTAGAACATCGAATTCAAGCGCGAGAAAT
CCAATGCGTTGGTCAGGCGGTGACCCTCACGACTCAGACAACTCTCAGCACAACCATTGGACAGCTTCGCTTCGAACGCATTGATCTGACTCAGCGTCAC
ATCACGACCCTTGCCACACTGCATGAACTCAACATGAGTCACCAAGCCGCCACGAAGAGTGACGTTGTAGCCACTGAACACATCTTCCGACAAGTTGATA
CCCTTACTAGCCTTGGACACACCGCCGCTTGTAACAACGAAAGACTTCTCGAACACATCGGGGTGGCCGTAGTGCATGCGCGAACGAAGCGGCTTAGCCA
GCACACGCTGGGTCAGCGTCACGAACACCAATTCCTGGAGCGTCATGAAACGCGCCAGCGATGAAGCACGGCCCGTGAAGACGTGCTCCTTCATACCGAT
CACAGTCACTTCCTCACCGGTGCTCGTAGCAGTCGCCAGGAAGTTGGGCATCTTTAGGCACTCCTCCAAGTAGTGCTCCTGGTTCATATCAATCGTTTGC
AAGTACTCACCACGCGTAAATGGCAATGCCACGTTCTGGTTTTCGGGCTTACCCTCGCCCAGAATCGGGTTACCAGGCAGTTCGTAACGGTAGACTTCAA
CAATTTCTCCCTCTTCGGCCTTAACGAGCACACAGTCAAAGCGGTTGATTTCCTTGTCGCCGTCTTTTTCCGTTATAGAGTCCACAAAGCTGACGCGCCA
GCTCGGGAACTTCTTCATCAAGTAGTCGATATCTGCCGCACGAGGGTCACCGTTCGCAACCTGCTTGGAGTAAATCTGGCAACCCGTGATGTAGGAGAAT
TTCAGTGCAGAAATGCGGTTCATCTCCTCCAGCTTATCTTGGATACTCATATCACGGAGAGAATACACCTCGAGCCAACGTAAAAGACGGATGGCGTCTT
CGTACAGCATCATGCCGTGAACTGTTCGGGCAAGCGTCTGGCCTCGCATCGAAGCCCACAGCCGCACTTCGGTCGGATTGATTTCAAGAGCCTCATCCAG
CGAGGTAGCACCCATTCTTTCCAGAAAGTTACTCCACTCCTCAGCGTGGAACGTGATCAGATACTTCATGATCGTCAGCTCCGTCCAGCCCTTGGCCTTC
TGCTTCTTCTCGAGCTCTGCGAACAGCGGGTTGGAGTGTACAGGGTCGTTCAGCTCGTCCAAAGTGAACAATACGGTTTCAGAGTAGTACGGAGTCATCA
CGGAGAATGATGGCATGGCTTCCATCGAGTCCACACGGGGCATCTCCATCGCCAGCGAGTGGAGGAAGAAACCCATGCGACGCTTGGCATCCTCACAACG
AGGAAGCGAACTCGCAACATCCAAGCGGAGCAAGAAGAATAAGCGCGTGCAGCTAGAAATGAAGTCCTCCGGGTTAAAGCGCTGTGGTGGCGTAGCAGGT
CCCTCCCGTGGGTGAACAGCGATCAGACCAGTTTCAGCCATAGCATCAGCCTTGTAGAGGTATATCAATTGCTGGGTCTGGAACTCGAGGTCGGCCGTGG
TCTGCAAGAAGCGGCAGTTGTGCACTTTGCGCGAGACGGTATCATCGTTCAGCATCAGCTCTAGTGTCAGCGCAATGGCGCGCAGGCGGTCAACCACTTG
CGCGACTTGCACGTGGAGTTCCATGCGCAGTTCCTCGGGTGTAGACTCCAGTGTGTCGATCGCCGAAATATCTTCCGGCATATCCAAGATCACGGCAAGA
AGCTCGACCATGTTATCCGCAAGCTGAGGCAAGTAGGTCATGTCGACCAGGCTCACGACGTCCGGCGACGAGTAGATATACTCGAGCACTTCTAGCGCAC
CCTTCTCGTCCTCACCAAGCAGCAAATAGAAGATATCTCGAACAAGCTCCAGCCCATTTTTCATGCCTTCCAGGGCGTCTGCAGTAGCGATGTTTTTAAC
TAAAGTTGCGGTGTCCCACTTGCTAGAACGCGACTTGGCTGCAACATCGACAGCCTTTGACAACTTGCCAGCCAGCAGGAAGATCGGCTCCTGGATCCGC
TCACCCTTGTCCAGGATACGGTACTGCAAGATAACAGTCTCACGATCGTCGAGCAGATCATTCAAGCGGAAATTATCAACCACCTGGTTCCAAATGATCG
CGAAACGAAGGCGCACAACGTCGCGGTGGCGGAGCTCTCCAGCATCACCACCGCCAGGGACAGGCGTCACTGCTTCCGGGTTGGGCGTCTTGGTTTTAAG
AGACACCACCTTCTCATCAAAGAGCTTCGGTGCCCCCGACATTCCCTTCTTTAGTTGGGCCAATCCCACGTAGTGGCCAAGGTGCATGCGTTTTCCCATC
ACGAGCCCAACAAGGGACTGATACAGGATAAACCAAATCTGCGAGTCGTACATGTACACGACGAAGATGGGGGCCCACAGCGCGATGATGAATATGATGT
TGTGCCCCGATTGGAAGACGCCATCGTCATCGACAGTGATATCATAAATCTCAATCGACGGCGCCATCAACGGCCGGATCATGAACTGCAGCGCGAACAG
GAACTTGCAGAAGAAGATGATGTACCACGACATCGAGTACCTTGAGTAGTCCTTCCAGGGTTGCGCCGTGTCGCGTCCCACATACTGTCGGCTGGTACCA
TCCAGCGCGTTCACAATGCGAATTCCCCAAATCGCGTTCGGGAAGAACGCGCGGATCGTGGCCGCCAGCAACACCGGAATGCAGTAAATCAGTATGTACA
TCAGCCCCATGGACAAGTACGTTCCGGCAGTGCCTCCTCCTGGCAAAATGCTGCTCAGAGATCCCAGCACCGCCGACCCGTCCGGCGAAAAGTTGACCGC
CATGAACAGCGCGAAGAAGAGCGTGTGCCAGAACAGCCTGCAGAAGACGCCGACGGCCATCCACACGTCCTTGTAGAGTCTCAGGCCGAAGAGCCAGATC
TGCATCACCACCTTCATGGCCAGCAGGCCCGTGACGGTGATGAAAATGGTGTAGAACGCGTGTGCGCGGATCTTGTTCTGGCCGCTGTCAAAGATGCGGA
AAAAGAAGCCCAGGCCTCCGTCGTCGTCGCCCTCGGCCATGTACGCCACGTACGTGACCACCACGAGGACGTGAAAGACCACAACCAAAAAGTACCAGAC
CCTAAAGAACGCCAGCACGGGGTTGAACACGCTGCGCTTCTCCTTGAACGTCTTGGGGTCGTGCACTTCCAGCATTTTCGCGACGTTCATCTCGTCGCTT
TCGAGGCATTTATCTGTCCAAAAGAACTCGTTGATATCGTCATAATTGGTCGTGTCTTGGTGGTCGAACGGACGCTCGCCCTTGGGTGCCGTGGCTGTAC
GCATCTTGGCAATCACGCCGTACACGGGGCGCACAATCTCGTTGAGGTAGAAACCCTCGTCCACGTCCTGCAGCGTGTCCAGGAAGTCCAACTTCTTGGC
CATATTATGGTACAGGAAGCACACGCACTCGGGCATGAAGCGCAAATTGCCGGCCTCCCCCCAGAGCAGCAAGAACAACACCAGCTCCTTCTCCGTCTTG
GCTGTGGCGTCCTTCTCTGGGTCGCAGCAGCGCGGTGGCGCGCGGAGGAACTTACACCAAGCCACGTAGTTCTTGAAGAACTTTTTGTGCACGCGGGCGA
GCGCGGTGCGCGTCACGAAGTCGCTGCTCTCGGCGGCACCTTGCGGGGCCTCGGCGCGCACGCGCATCTGGTAGTTGGTGATCCAGCAGCCCAAATTCTC
CTTCTGGTTGGCCACGCTGCTGCGCTGGAAGCCGAACTTCCCCTGCAGCAGCTCG