Description :
From Genome Similarity Track
Location :
contig_65:161189- 162414
Transcript NameFunction/comments
g11764.t1ETI45962.1 hypothetical protein F443_09601 [Phytophthora parasitica P1569

Sequence
1225 bases(100 bases per row)
GGACGAGACCTTCTGCGACTCGACCAAGCAGCTCAGCGGCTACTTCAAGATCTCCGGGTCCAAGTCCAAGAACTACTTCTACTGGTTCTTCGAGTCGCGC
GGTTCGCCGTCCACGGACCCCGTGGTCATCTGGCTCACTGGCGGCCCGGGCTGCAGCTCCATCTTGGCCTTACTGCAGGAGAACGGGCCGTGCTCCGTTA
ACGACGATCTGTCACTCAAGAGAAACCCCTACTCGTGGAATGAAAGAGCCAACGTCATGTGGATCGATCAGCCCGTCGGTGTGGGCTTCAGCTACGGAGA
CGTGAGTGAGTATGACACGTCGGAGAAAGAGGTGGGGGACGATATGTTCCACTTCCTGCAGGAGTTCTTCCAGGCTAAATCAGAGTACCAAAAGCAACCT
TTTTACGTGTTCGGGGAGAGCTACGCCGGCCACTATGTGCCGGCCATCTCTCACCGAATCTTCACTGGTAACCAGCAGAAAGAGGGACCCGTGCATATTA
ACTTGCAGGGGTTCGGCATCGGCAACGGGCTAACAGACCCCGAAGTGCAGTACAAGTACTACCCCGACATGGCCTACAACAACACGTACGGAGTCAAGGC
CGTGTCGTATCCCGTGTATTTGGCGATGAAGGCGGCGGTGAGTCCCTGTGTGGGCATGATTTCCGCCTGCCAGACGAGCAAGGCGGCGTGCCTGGCGGCG
CAGACGTTCTGCAATGCTGCGTTAGTGGCGCCGTACACGGCGTCCGGGTTGAACGTCTACGACATTCGATCCAAGTGTGCACACCCTCCGATGTGTTATT
CTTTTGAAAATGTGGAAAAGTTCCTGAGGCTCGAGAACACGCTGAAGAAGCTGCACGTGAGTCCCAAGAGCGCTAAGTGGCAGAGCTGCAACATGGAAGT
CCACGCCGGATTTTCGTTCGACTGGATGAAGAACTTCCAGCAGTTGGTGCCGCCGATGCTCGAGGCCGGCATCCGAGGTCTGGTCTACGCTGGGGACGCT
GACTTTATCGTAAACTGGATGGGATGCAAGGCCTGGACGCTGGAGCTGCCGTGGAGCAAGCACGAAGAGTTTCTAGCTGCTAAAGACAAGGAGTGGGTCG
TGGACGGCAAGAAGGCGGGCCGACTGCGCCAGGTCGGACCATTCTCGTTTCAGCAAGTGTACGAGGCCGGTCACATGGTGCCTCTCGATCAGCCCAAGAA
CGCGCTAGCGCTGCTCAAGGCCTTC