Description :
From Genome Similarity Track
Location :
contig_29:16118- 19052
Sequence
2934 bases(100 bases per row)
ACCTTCATCCGGCGGATCACGATTCGCATCGTGATCCGCGGGGGCCCCGTAGGGGCCTGGGGAGGGGGGTAAGGCTTCTCTTCTAGGTCCATTTCTGAAC
CCGCCTCCTTCGCATCGTCAGAGCTCCTCCCGGCACTCTGTCGATCAGATGATCCTGGCGCTTTCAGCGCCGTCGACGGCGATCCATCTTCCGTCGACGA
CTCCATTCCTGGTTCTATCTTGCTCTTGACATCCTCTTGAGTAGACTCACGGTGAAATCCCTGTGAGTTACCAGAAGATCCGGGCACGCGCACCATTGTG
GTGGAGCGGGATCACGAAATTGCTGACGCGATCGCAACTCACCAACGGTTGCCCGGACTGCCGACTGTCGGAGGGGGTACTCCGTTGATCCGGCGGATCT
TGACCTTACAGCTCACCTTGTGTACCCGACGGCTTGGGCGGGTTACGCTCTTCCGGTAATCACGCGAGGGAAGTCAGTGGTGAACAGGGCAGAACTGGGG
CTTGAGGGCCCTTCAGGTATGGGGGGTGGTTGGCTGCCACGCGGATATGCTTCACGCAGCAGTCGGTTGGGTGTGATCGTGTGTGATCGATCACGGGGTG
TGTCCTTTACGGGGTCCTTTTCGATGCTTGCCGCCTCCTATGGCGGGGTCTTGATGAGTTGGAGGGAGAAGGGGAGCGCACCTGGCCAAGCTATCCAGGG
GCTTCCGCGTTCTCGCTTGAGTCACTTCAGGTGGTTGTCCGGTCGTCGGGTAGGCCAATATACTTCCTTCCCCGGAATTCGGAAGACCACTTGCGTGCTA
CAAGGAAAATCTCTCTCTGTTTATCCATTAAGAACTACGTGCCTATCCCCCATCTCTCTTGCGTATCTCATGATTGCTGACATTCTTGGACCTCCGATGT
GCCGGTATTTGTGGTACGTGCTGATCTGATCGGCTGATTTGTACCCATGTCAAACTGATCGGTCGATCGGAACCCATGTTGATCCGATCGGTTGATCTGA
ACTCATGTACCCAACATGTGGTACCGCGACCAAATCTGCCAAGATCGGAATGATGGTCTTCACATTCACCGTCCGGTTGTCCGACCGTTGATGCCGCCCA
TCCCAGGTCCAAAGCCATCCATCCGTACCCATCAACCAATCACCTGGTCGGACACGATCAATCCATCTCCAAAAACTTCTGGTCACTTCTCCACACACAC
TATCAATTCGAGGGACAACTTCTACAGAATATCACAGGAATATGAAATGGGCAAACGCCAGCAAGCTAGGATACAAAATAGGTGGGTCAACCAAGGATGC
CGGAGCGTCTCTGGTCACTACCTAACTGAACTTGATGTTATGAGGTGGAGATGCCACAGACGACCCGCCCTAAATGGTCGCAGCGTCCTTTGTTGTATCG
CGGTTGTAGTCTCAGGTCCTCTGGATTTCCGACGGTAGGCTTGGCCGAATTCACTTACGCAGTACTGGTAAAACAAACTCTGCTGTTGGCTGTAGACCTC
TTCCTTCTAGATTTCGGCACTGGGTGCTCTATCTTGGATTCACTATGTTTTGGTTAAAATATCTTTGCTTTAGTATGATCTGGGTACATTGTTTTCGCAA
CTTCGAAAGTGTCGACTCGACAGTTCTGCTAAATTATTGGTGGTAGTTCAAGTTGCGTTTTACTTGATGACGTACCACTGTCTTCGAACCCAGCAGTCAG
TAGTCGATTGGATGCACATGACACCCTGACTCTTGGGGCTTCCAGCACACGATTTAGGTGTTGGTTGTAGACGATCTTGGTTCAGTATCTTTGGTAGTCA
CTCTAAACCACAGCAAGATGAAGTGCAGTCTGGTATATGTTCCCAACTGTACTTTCCACCAGGATTTAGGCGCTCGTCGTAAGGGAAAGTCTGTTGGCTG
GACAGAATGCGGGTTTGCAATCCTGGATGTGTACACATCCAGGATTCGCGCAGTCGTTTGGACGCATCTGCACTTAAGCGCAAGATCTTTCCATAAATCA
GTTGCACCTCCTACGCCACCCGTGTCGCACGGGTACAGCCGACCCACAGTCTCCAACTTGTCCAATAGTTTCCAGGCACAGCATTTTAGACCAGAGTCGT
GACGGTATTGCGTCACAGGAAATCCTGGAGCACTCCGTGTCATCAGCAATTCTTTGTAAAGGAAACCAGCAAAGGTTTATTGTACCGTGGCTTGGTAGTA
CGTAACGCTGTTGATCCCTCCCATAAGAGCCCATATCGGCGTGAACACGCTCATGTGCATAAGGAAAAAACCTCTGGCTGCTGAGGGAAATCAAAAGCTG
TCAATAGCCCTTGCAAAATCGAGGAGAAAGTAGAAGTTGGAGTCTTGAAGATAAGCGAGAATGACTTCCAACATCGGCATTGGATATAACATTTGGAGAG
TCTGAGTATTAGTTCCTCTCACGTCCACTGTCATAAAAAAAGATCCGTATCTTGCTTGTTTACAACGAGCGGAGAGGGACACGTCCAGTTCTACACCGCA
TAAAATTGCGATGTTGGGGTGGACATCGACATGCTTTGCACATCATCCGGCTTCAACACCACCTCGAGCGGGGGCATATCCTCCAGTGGATCGTTCATCC
GAAACATGTCAACCTTATTCCACACCACTCTCCAATTTGTTTAGCTACTTAATACTCGCTCCCTTGACTTCAGCATATTTGATCTTGTCCAACAACAAGT
CCCCAACTGCGCGCTGTTGAGACTGATTACATTACGCCGGACACTGGCACTAAATATTCCACCATGCCCGAGTCCCTAGTCCAGTGCTTGAGGGCTTAGA
GACAGTCGCTGCCGATACGAAACTTGGGGTGCAAGCTCAGACAGAAGGGTTTGGGGTGATGTCGTTGTTATCACACAGGAGACCAACCTCAATATTTGTG
TTGGTACCCCTGTAGGAAAGTTACTTCTGACTAA