Description :
From Genome Similarity Track
Location :
Scaffold_262:16115- 18012
Transcript NameFunction/comments
Phymu_g7708hypothetical protein

Sequence
1897 bases(100 bases per row)
AAGGCCGCAGACCATGGAAGAGAACCCCAGTCAGTGGCAGAGGCGAAGCGAAGCAAGCACTGGACCGAGTGCAAAGCTGCCATGGGCAAAGAGCTGGCAG
AGCTGGGCGCAAATGGCACCTGGGAGCTGGTTGACGCACCCGACGGAGCCAACATCGTCACATCCAAATGGATCTACAAAATGaagttcagcagcaacgg
tGAGCTGGAACGGTTCAAAGCCCGCTTGGTGGCACGCGGATTCACCCAGAGGTACGGCATCGACTTTGAGTCCACGTTTTCGCCGGTTTTGAAGATTTCG
AGCTTACGGTTCATTGTGATGCTAGCTGCGTTCTGGAAGGTCAAGCTTCGCCAAGGTGCTGTCCCGAATGCGTACTCAAAGTCAGCTATAGACAAGTCGA
TTTACTTTACGCCACCTACTGGACGAACAGGTACCGACGGCCATCGCGTGTGGCTACTCTTAAAAGGGTCCTACGGCTTAAAGCAGAGCGGCAAGCTGTG
GAATGACCTCATCGATTCGTTCTTACAAGCGCAGGGCTTCCAGAGACGCCGCATGGACCCGTGCCTTTACTTCTTTTGGCAACACGACACACTCTGCGTT
TTGGGGctctacgtggacgacatccTAATTGTGAGCCAAAACCCGACGCTATCTGATCAAGTGATGACAAAACTCACCGAGCGATTTGATATCAATGACC
TCGGCGACGCTCAGAAGTGTCTCGGGATTTGGATTGGTTACACTACGGATGGGATCACCATTCACCAGCGGCAGACTacgctggatctgcttgcTAGAAT
AGGGATGGACCAGTGCAAAGCGACCTCGACCCCTATGGATGTCAACCATCGCTTCTTCGAGGAGAATGGCGACCTTTTCACGACACCACACTCTACCGTT
AAGCGATTGGCAGCCTGCTCTGGATATCAAATTGCACGCGTCCCGATATCGTTACTGCGATCAACTGCCTCTCTCGCTTTGTTTCGTGCCCAACATTGGT
ACACTGGAACGGGGTAAAGCGGATTCTTCGGTACCTGAATGGTACGACCGACGTCGGGCTGTTTTACAAGTTTGGGAATGGCACCGCGTCAAAACTACAG
CCGATCGTCTATTCTGATGCAAACTGGGCCGGCGATTCGTCAAGATCAAAGTCAACGAGCGGCGCAGTCCTTCAGATCAACAGCATGGCCATCTCGTGGT
TGTTGCGGAAGCAAACTACCGTGGCCCTGTCAACTTTGGAGGCGGAATATGTTGCTGCGTGCTCTGGTGTTTAGGACTGCATTGCGATTcatcgacttct
tcaagaGCTCGGGTTGATGCTGCAGACCGATGCAATTCTACTTCTCGTGGATAACCAGTCAGCGATAAAACCGATGGAGAACGCAGTCACTACTCAACGC
ACCCGCCAGTTACAGATCAAGTATCGCTTCATCCGGGACGCCATCACAAACAAGAAAATTCAAGTGGAGTATTGCCCgactcagcagcagcttgtcgatA
ATTTCACGAAAGCCACCGATCGCATCATTTTCGGACGAATGTGCAGCATGCTTCGCCTCACAAGTCGTGCTTGAGGGGGAGTGTTGCAACATTAAATTCA
TGCAAGCATTACTCCGGTGATATGCAGCCAGCGAGGGCGACGGACGCACACACGCGGGGAAAACATCTACTGCGCATGCTCATTTCAATTCAGCTGAGAG
GACAGGCAACGAGTACGACCGTGGCCCCCAGCTAGCTACTACTACTTCACAGCACCACCGAGGAGACCAAGCGGATATAGTCCGAGCTCTCAGCTCCGGT
TCCTGACTGTGAGCacgacttcaacaccttCCGGTCAATTTTGACGGAAACGAAACCTGGTGCGATGGAGAAACTAGACGTGATACCACGCGAGCAC