Description :
From Genome Similarity Track
Location :
Scaffold_397:16113- 18302
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_397-snap-gene-0.13Lysosomal beta glucosidase

Sequence
2189 bases(100 bases per row)
GACGATACGCGAAAAGGTGGCGCAGATGACGCAATTGGATATCTACTCGATGGTGAATGGAGACGTCCGCGATCCCGCGCGCGCACTGAACAAAGATGTT
GTGACTAAGTACGCCAAGGCCGGCATCGGTTCGATCCTGAATGCTCCGTTCAATGGCCGCATCACTGATGGGCGTACGGGGTGGAGCGCAGCCGAGTGGA
AACAAATTATTGACCAGATCCAAGGAATCTACAAGCAATACAACCAAATCCCGATGATTTACGGTATCGACACTATTCACGGTGCAACATATGTTCGTGG
TGCAACGCTGTTTGGCCAGCCGATCAGTGCAGCGTCGTCGTTCAACCTGGACTTGGTATTCCAAATGGGCGAGATCGAAGCCAAAGATACGCTCGCGGCG
GGCATCCCGTGGGTGTTTAGTCCTGTATTGGGCATCGCAGTGCAACCGCGATGGGCGCGTGTGTTCGAGACGTTTGGCGAAGATCCGTACGTGTCGTCCC
GCATGGGTGCATCAATCATTCGCGGTATTCAGAGCACAGGTCAGGTCGCAGCGTGCATGAAGCATTTTATTGGGTATTCGAATCCAGCATCTGGCCTTGA
TCGCGCCGACAACGTGATTTCGGATTGGGACCTCGTAAACCATTTCGCACCATCGTTCTTGGCCGCGACTTTGGAGGGCGGCGTGAAAACCGCCATGGAA
TCGTACATTTCGATCAACGGCGAGCCTGTGATCGCGAGTCATCGACTGCTCACGACGTTGCTGCGCCACGACATGAACTTTACGGGTATGCTCGTATCAG
ATTATTCGGAAATTGATCGCATGCACTCGGAGCATCATTTGGTACCGAGCGTTGCTGATGCCGTGCGCGTATCGCTCACAGAAACGTCTCTAGATATGAA
CATGGGACCCAACATGGACGATTTCCTGAACATCGTCGAGAGCCTTGTGGCAAGTGGCACGCTCTCGGAAAGCCGACTCGATGAATCAGTTTTGCGAATT
CTCCAATTGAAAAAAGATCTCGGGCTCCTCAGTCAACAAAACGAGAAGGATAACAACGTTGCATCACCATCAAGCGCCTCTGCCATGGATGTCGGCAGCG
CTGACGACCAACGCGTCGCTCTGGCGTTGGCACGGGAATCAGTGATCTTGCTTGAAAACCGGAACCAAACACTCCCGATTCAGCTTTCAGCAGGAGACGA
GAACAAGAATATGAGTATTTTCATCACTGGCCCGATCTCCAACAACAAAGGGTACATGTGTGGCGGCTGGTCGGTCTTTTGGCAGGGTTCGTCGAATTCA
TCGCATTTTCCGAATGGTATGACATTTAAAGACGCCATGATCAAGCGCGCGGCTGCAACAACAGCACAAAACATTCACATCGAGCACCTCGATGTCGTTG
ATGTTGATGGCAACATGTCTGGGGAAGATTATGGAAAAGCTGTCGACATCGCCTCACGAAGCGAGTACACGATCGTGGTACTCGGTGAGGGCAACTATGC
TGAGAAAACGGGGGACATTGCAGATCTTTCGCTGCCCGAGGGTCAACGGAAGTACCTACACTCCTTAACCCAGCTCCCATACACTAAAGTGATTGTTGTG
TTGATTACAGGCCGGCCTCGGTTGCTATACGGGTCGCATGACGACGCAGATGCCGTGCTGTTGAGCATGCTACCGTGCGAACAAGGCGGCGAAGCACTCG
CGGATATTGTGTTTGGGGATGTAAATCCATCGGCAAAGCTTCCGATCACGTACCCGATCGCTGAGGGCAAGCTCTTGCCGTACTTCCACTATGTCAACAC
GAAGTGCCAGCCATGGGATGAATGTCCCGTGCAATGGGAGTTTGGTTATGGGCTGAGTTACACCCAGTTTCACTATTCGGACCTGAAATTGAATGCGACG
ACCGTGGATGGTGCTGATGGAGCTTTACAAGTCGATGTCACGATCAAGAACACGGGTATTGTGGACGGCAGCGAGGTTGTGCTTCTTTTTGTGTCCCAAA
AGTACCGTTTGGCGCACATACCGGAAACGAAATTGCTTAAGAAGTTTCAAAAAGTGCACTTGAAAGCTCAGACAGCAACACAAGTCTCGTTTGTGCTGAA
TGTGAACGACTGGGGCTTTTATGATCCTGAGATTGGAACCGGGTTCCAACGTCGATTTGAAGCTGGTGAGTTTGAAGTCTCGATTCTGC