Description :
From Genome Similarity Track
Location :
Scaffold_117:161126- 162756
Transcript NameFunction/comments
Phyci_96195pyruvate kinase, putative

Sequence
1630 bases(100 bases per row)
TGCGCTTACTGCACGTCGGCGACGCCCATGACGATTTCCCGGCCGAGGTCGTCCGAGAGCTTATCGCCGCTGATGACAACGACGCGGTCGCCCGAGGCCA
GCCAGCCCATCTTCTTGGCGTGCGCGATGGCCTCGGCGGTGGTGGGGCGGCGGTCGAGGTAGTCGGGCACGACGGGGTAGAGGCCGCGGTGGATCTGGAG
CTGGCGGCCCACCTTGAGGTTGGTCGTGAAGCACATGACGGGCACCGTCGGCTTGTACTTGGCCACCTTGCGGGCCGTGTAGCCCGTGGCGGTCAGCACG
ATCATGAGCTGCGCGTTCATCTCGTTGGCCGTCTTGACGGCCGAGGACACGGCCGACTCGACGTCCGACGTGGGCGGGTCGAACTGGAACTTGGCGCGGT
ACGTGGGCTGCAGCAGCAGCTCGTCGGCCTCCTTGATCACCGTGTTCATGGTGGCCACCGACTCGACCGGGTACTTGCCCTGCGCGGACTCGCCGCTGAG
CATCACGCAGTCGGCGCCGTCCAGCACGGCGTTGCCAACGTCCGAAACCTCGGCGCGCGTCGGGCGCGGGTTGTTCTGCATCGACTCGAGCATCTGCGTA
GCCACGATCACGGGCTTGCCAACGGCGTTGCAGCGGTCCACCATCATCTTCTGGTAGGTCAGCACCTTCTGGGCGGGCACTTCAACACCGAGGTCACCGC
GCGCGCACATGATACCGTCCGAGGCCTCGAGGATCTCCTCGAAGTTCTGCACGCCCTCGAGGTTCTCCACCTTGGAGATGATCTTGGGCGCGATGTACTT
GGGCTGGTCGGCCCAGTGCTTCTTGATGCACTCGTCCACGAACGCGCGGATCTCGTTCACGTCGCTGGCCTTGCGGATGAAGGACGCGGCGATGAAGTCG
ATGTCGTGCGCCACGCCCCAGTCCAGGTCGCGCTTGTCCTTCTCCGACAGCGCCGGCAGCTCCACGATGAGGCCCGGCAGGTTCACGCCCTTGCGGTTGC
CGATCTCCTCCGTGTTGTTGATCTCGCACGTGATCTCGCCCTTGCCCACGCTCGTGCACGTGAGGCGGATGAGGCCGTCCGAGAGCAGCACCGTGTCGCC
CACCTTGACGGTCTCGGCCAGCTGCTGGTACGTCACGTAGAACTTGTCGGCCGTGCCCTTGAGCTCGAAGGCCGCGTCCGTGGTGAGCACCACGGACTTG
CCCTTCTCCAGGCGGATCTTCTTGCCGTCCAGCATCTTGCCCGTGCGGATCTCCGGGCCCTTGGTGTCGTGCAGCACGGCGCGCAGGTTGAACTTGGCCT
GGCCCTCGGCGTGCACGCCGCGGCAGGCGCGCAGGTTGTTGACGCGCAGCAGCGCCTCGTCGTACTCGGCGTGCGAGAAGTTGATGCGCATGATGCGCAG
GCCCTCGTTCGTGAGCTTCTGCAGCATGTCGAGCTGCTCGGACACGGGGCCGATGGTGCCCACGATCTTGGTCATGGAGAACTTGGAGCTGCGCGGGTTC
TTCCACAGCTCCGAGGCCGACGCGATGCCGCGCGCGTTGCGCAGCGTCGTCTTGACGGAGCGGAGGGCCAGGCGGCGCAGCATGACTGGAGGTTGGGAGG
AAGGAAGTGGAGGGTGCGGGGGACGAGGAA