Description :
From Genome Similarity Track
Location :
Scaffold_131:16110- 18675
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_131-fgenesh-gene-0.4DNAJ
Pytve_DAOMBR484maker-pve_contig_131-fgenesh-gene-0.1Endomembrane protein 70

Sequence
2565 bases(100 bases per row)
AAACCAATCGCCATGGCTCGAGGCAACGTTTGGATCACCTGGACTCGTTCTTCGTCACCGCAGGCTGCTAGGTATTCTTGCAAATCGCTGAGCTCGGGTC
GTGCGGAGCCGGACGACGAGCCGGATGCTTCATTCTCCTTGTCTGTATTGCCCTTCTTGCGTTCGTCGTAATCTAAGCGCTCGAGGAATAGCCTCACTTT
CGTCGGCAGTCGCTGGAACGCAAGCTCACACATCGCCAGCTGTGCGATGCTGCCGGCCATCGAGTGGCCGCACAAGATGAGCACCTTGTTCAACTGCTGC
GCTCGACGATACAGCGGTTGAAGCTCCAAGCGCTGCGCTCGCTTCCAGAACGGCGAGTGGATTCTCGCGCCTCCAAAGCGATGTACAAACGGCTGCGACA
CTGGCACCGCCGAGTTCACCACGGCCTCAAGGATGTCGCTCGTCTTGGTGGCGCGGATCGCGCAGATGACCGCCAGCTCCGACTCCATGATCACATATTC
GTTCGTGAACTCGAGCACGGGGAAGAGCAGGTTGTGCGGCAGCGGGGACTTGCGAACGTGCGCCGACAGCTCGCGGACAGCTCGATCCTTCGTCTCCGCA
CTGGCCGACGCTGTGACTTCGGCCTTGGTCGCGCCTAGCGCTGCGCACAACACGGCAGCACTCAGCAGCTCGGTCTCGCTGGTGGCGACGGAAATGTCGG
TCGCCGACACGGCGTCGCCCGCCCACCACCACGCGGGTCGAGCGGGAGCCTCAGTCTTGGCCCCATGTGGCGGCTGAACTACCGTCGACAGCTCCATGGC
GAGAAGCGGAGTGCACGGGCGGCAACCAGCAGAGCTTCTCGCAAGCTCAGTTCCTTCTCCTGATTCGAGCGTGTCACATGTTCGAATGCCGGGCCTGCTT
GTCTTCGGCTATTTTGTCCAATCACCATACCACACATATAATTAAAGCAATCATAACTGGCTAAAATGATTTTGCAATTGCTGACTCATTTTGGGCAAAT
CAAACGAACCCAAATGACTTCATTTCAACCAATTATATCTAACGACTTCGTCGGTCGTTTCGCATGGGCAGATCGGAGATATTGGGCGATCGTCCTGCTT
GCTGCTTCGAACACGCACGCACGGCTTTTCTGTGTGTGTGTGGCCCCGCAATGGCTTCCCAGCGAGCTCGAGCGCCTTGGTTGGCCGCGCTATGGGCAGT
CGGCTCGATCCTCTTGGCGACCACCGTGTCCGGCGATGACGCGGCCGAATACAGGATCCGAGACGAGGTGTTCGTCGTCGCCAACACGGTGGGTGATTCA
CTGTTGTAGATGCAAACGGCTGTGTTGCTATGCTTACCACGACGAATTGCGGCTGTCACGAGCAGATTCGTCCGTACGCGAACCCGACAGAGACGTACCA
GTACTACAAACTGCCGTACTGCAAGCCCAAGGAGCGCCAGTGGGACGACCACGACTTGGGCGAGCTGCTCACCGGCAGCCGCAAGGTCGTGACGGACTAC
CGCATGTACCTCGGCGTCGACCAGACGTACGCGCAGCTGTGCAAGCTAGAGATGACACCGGAGGTCGTGAAGGCGTTCACGGAGGCCGTCGACGAAGACT
ACGAGATATCCTTTCAACCCATTTGTTACAAATCATGGCTGCATTTTTGGCATGTTCAAGTTGCTAGACACCTTGACTGTTGTGTTGGCTGATGCTGCTT
CGGGGCATGCACTTTGAGATGTATGTGGATGACGTGCGCCTGCAGGGCCAGGTGGGCTACCTCGTGCACAGCGGCAAGGCGATGACCGAGAACTTTTACT
ACCTGAACACCCATCTGCATTTCGACATTGCCTACAACGACGTTGACATGGAGAAGGGCAAGTTCAAGGTGCGTCATATGGGCAGCGGTGATATCGTTCG
CTTGGATGCATGTTGTAACGATGTTATTGTGCTGTCAGATTGTTGGCTCCAACATGACGATGGCGTCGTCCGACCCCGACCTTGAGTACCACTACGCGCT
GTCGGCAGAGCATATCTCCACTCAGCCGGAAGCCGTGTTCACGTACTCGGTCAAGTGGCACAACCGGCCTGACCTGCTGTACGAGAACCGCAACGCCGAG
GAAAACGCGTTCACGGACGACCTGGAGCTGCACTGGATCTCGGTCATCAACTCGTTCATCCTGGTGATGATGCTCACGGGTTTCTTGGCGATCGTCATGG
TTCGCATCCTCAAGCGCGACTTTTCCAAGTACATGGACGTGGAGACGGGCAATGTTAGCGGCGAGGATGACGACTCAGGCTGGAAGCTCGTGCACGCCGA
CGTGTTCCGGTTCCCACAGCATCTGAGTCTATTCTGCGCACTCAACGGCGCTGGCGCGCAGCTGTTCGTCATGCTCACAGTGGTGCTTGGATCCTCGTTG
CTGGGCCTCGTCAAGCCCAACAAACGAGGCGGAGTCATGACGGCGATCATCATGTTGTACGCGCTGACGGCTGGAGTTGCTGGGTACCATTCGGCTCGCC
TGTACCGCCAGCTTGGCGGCCAGCGATGGGTGTGGAACATCCTGCTGTGCGTCTTCAGCATCCCC