Description :
From Genome Similarity Track
Location :
scaffold_37:1611- 8541
Transcript NameFunction/comments
g11079.t1hypothetical protein

Sequence
6930 bases(100 bases per row)
GGGTAGTTGTGGTGGTCCTGCCGAACCGCGTCTCAATCGGATATCGCTCCGAAAGTGGATTTTACGATGTTTGCAAGTCCATGGACACTAATTTGAAACA
CACCATGCGTTCATGCTACTAGCATTCAACTATTTTGCATCGGAAAATGCGAGACGCACGCTCTACGTGAAAATGAATGTTAAACGACAGGCGTTAAAAG
CCGCAGAGATTACTCGCTCTACTGTCCTAGAGGCCATACAATATTTCAATCACTTGACCGTCTGTCGTTCAAGAGGCATCAAGCCGCACCCGCCATCTCT
TGCAGTACAACGTGTGATCGATCTAAGAAAGAGTCTACATGTACCGGAGTCTGTCTTTTATGGCTCAAGCAATGGGCTGATGCTGGCTCATCACGACTTG
TTCGATCTGAAGAAGTGGTTTGGACCGCTACAAATTGTTTTCACGGTATCACCTGACTCTGCCGGAACGTGTAGCATTGCAATCAAGTCCGGTAGGGTGA
CTGAAGTGGTGATCAGACACGCAAACGTAGCACTGTTACCCAAAAGAGCTGCATTAAAGGCAATAACCGCTCTGCACCCGGTCTAATGTGCGCAATACTT
CCTGTGAATGATGAAAAACACAATTGAGGTATTGTTGGGATGGGAACCAAAGGCGCATGCGTCAAAGTATGAAGGAGTCATCTTTGGCGTCGTGCGAGCA
TTTGATGATGCAACCGAGACTGAAATCGCTGGTGACTTGCATAGTGTGGCTGTATGAGTTCCCTGCTACTTCAGAGGCTTACAATGAGGCATTGGAAAAG
AACCCAACTATCCAGCAGCAAGTTGTGTTACTGGCCGACAACGTTCTCTCTACGAAACCGCCTTGCATTGTGAACGAGCTCAGATGTCCCTAATTGTTTA
GCAGAAGATTCGCTGCAGCCAATTGTTCCAGACGTTGATGCTTTCCGCCGCCCTGCTCCTGGGGCCTCTCCCCCTGCAACAGCTCAATGCAGCAACTGCG
ACCAAATTTTCCGTGATAAAGACATAATTAACCCTTTCGCAAGGAGCTGCTATAGATTCTACGAACTATACTATACAAAGTCAAGTCAATTAAACTCAAA
GGGCGCAAAATTCGCCCTTTTAGTTGTCGATAGAGACGGGGCGTGTGTGCAAATCAAACACGATGCAGTCGGCACTATGATGTCCAACCTAAAAGGGCGC
AAAATGCGCCCTTTTAGATTGCATTTTGATTGGCTAATAAGTGGATTATTTGGTGTGATCCAGCTGAAACAGCCCTCTACTACTGTGATTGGTCAAAATG
AAATGGTACAGCGTTCCACCACGGAAAGATAACAGCGAAACTTACGAAGATATTCGCCTCGTCGACCGTTTTCTGGGTGATGACGCGCCAACGTTGGCCG
GAGGATGATGCTCGGCTTCGGCTTTCGCGTGAGCCTTTGGTGCGCTTCTTTCGCGCGCGCCATTGGCGCGTATATATCGCACCACTCTCTGCCGGACGCG
ACTAGTTGGCTATAGCTCTGTATCTGGCTCGTTTTGTCGCCAGCATTCTCACAGCTAATCGCTTCAGGTACAGCTACACAGCCAGTATGTTTGTATTCCC
GGCAATGCAGAGCAATGAATGTGCGGGTCACTCAATGGGTGCATATATCTTCGTGTTCGTATGACTCCGTTAAGGTATACTACGTAATATCTTCGACGCA
ATACACTGGTGCATATATCTTGCACACTGTATTCCAAAAGGGGGATTGCGTATGAAACGCTGTTCGCGCCAAATCATGGCGCCCAAAGCTTGGTCCCTAC
TGTCAGACTTAATAGCTTGTATGTTTGCATTTGTATAAAGAATAAAACTCATCCAATATCTGTATTTAGAAACCTTTATATTGACCACAAACACACGACA
CGTATCAGCCTTCCAGCTGATTCCTTCTCTCATTTCTAAAAGGAGCCGTATATGGCGGAAGCGCTGCCCGGGCAGAAGCGCAAGTGTACCGGTCCTGTAG
GCGCCAGCAAGCGCCGCCGCGCGGGATCTGGTGTCGATACAACACCGGCGGAGTCCGCCAGCAGTCTCGGAGGTGTTGCAGTGTTCAAGGGCGCGTGGGC
CGCGCTGAAGAAAGCAGGATGGACGTCCAAGAAACCGTCCAGCAAGGGTCTTGACTCGCGTTACAAATACATTCGGCCTGGGGGGAGGCATGATGGTGTA
GAGGGTGCTGATTTCCTTCTCGGCGAGCTGGCCGTGCTGAGGTATGTCGAGTTGGTGCGCAACCGTGACGCCGCAGCAGCTGCAGCCGTTCAAGACACAG
GCAAGACGTTTTGTCTGTGCATGCAGCGGTATGGCAAGTGGCTAGGTAGCTGTATGGCTAACGTTGCACTTGTTTGTGGCGTAGGCGTTGGAGCTCAACG
TGGAGAAGACAGTGGTGACGTCGCTAGCAGAGCTGCTGGACAGGCAGTCACTGCCGAACGTCGCCGACAAGGATCTAGGCATGGCGACGCCGATCAGGAA
GCCTCAAGCGCTGCAGGTGCGGTTGCGTCTTGGGAAGTTGGGCTACAACAGCGAGTGACGCGACTAACGTTGTGTTTGTTGGTGGTTTGACTAACGGTGG
GTGCATTGGTAACGCAGAGAATGATGTCAGATTCGATGAAGTCATGGAAAGCGTCAGTACAGCGGCGGTTGTCGCTCACGACCAAGCAGTAGTGACCGTG
CCTCTAGTGCACGTAGGTAGACGACGAGAAGGTACGGTTCGTCCGGCTGCAAGCGCCGCCAGCCCAGCAGGTGCGACTTGCGACAAAAGGCAGCGTGAGG
AATGAGCGCGTGCCGTGGCTAACTATGGGTTTGGTGTTGATGCAGGAGTTGACGGCAGCATCGTTGACATGACCGACGACGTCATGGTGGACGCTGAAGG
TGCTGCCGACCAGGCAGGTGTCGCTGTGCCTATTGAACGAGCGTGGTGGACGCGGTGCGCGTGGTGAACGTGGTGCGCGTGGGGGACGCGGTGGACGGGC
TGCTCAGCGTGCAGCTCGAGCCACAGGTACTAGAAATGCGGTGCTCGATCTCAGAGTGCAAGCAGGAATAGATAAGCTAATGGTGTGTTGCTGGTTTTGC
AGGAGCTGGTGCGCGTGGCGGTGATAATGGTGACACGGCTGGAGCAGTGGTTGTGAGCGCTGCTGCTAGCCGCGGCGACCGAGTTCCAGCTGATGGAGTC
GCGATCCCCGAATCACCACAGTCTGGGCGAGCAACAACCAGTGGAGTAACGGGTGCTACAACGACGCCAACACGAACACCACCCATCATGCTGCAGGACG
TGTACGTGAGCAAGCTGGTCGCGTTCTCGCCGGACAAGGAACGATGGATGAAAGCGAAGGTCTATCGGCCTATCGGTACTGCCTACATTATTGGCCGAGT
CTACCGCCAAGTCAAGAAGGGAAAACACGCTTCTCTTTTTCAGATTCGTTGGCTGGACAGCCAATTCCAGAGCTCAGTAGAGCACATCAGTGTTGGCATT
GTGCAGCTTGGGATCAAGAACTACGTTGCGTTAACACGAGTGAAGAACCCGGATTGGCGAATACTGGTTCGGCCTGATCCGACGAAGGACATCAACTTCG
AGGAGGACGACTCGGATTGCGAAGAAGAAGAGGTGTTCGAGGCTTTCGAGCCTACGGAATTGCTTCCAACCTGCCTCGCAGAAGTTGAAGCCGTTCGAAG
CATGCGATTCGTTCCGTCGGGTGAAGTTGCAGTGCCTTCGTACCTGTATCAGCACAGCGACGGATCGACGAATACCTACTTGCGTCCTGAGTTCATGCAC
TTGTTCGAGCATTCTGCCAGCTCAAGTTTCTTCGCCTACATCCCCCTCTACTTTGGCGCCAAGTTTTGCATGAGACGAACAAGTACGCTGTGGCGAACAA
CATCCGGATGATAAATCCGTTCACGCTCGACGAGCTGATGGTGTTTCTGGGCATTTTGTTTTTCATGGCAATGAACGACAAGGGCGAGTACGCAAACTAC
TGGGGTGTTCAAGCCGAAGATCTTATTTTTGGTGGCGTTTCCACATCGCTCGACGCTATCATGTCCCTGCATCGGTTCAAGCTGCTCCGTCGGTGCCTGA
GCTTTAATGCTACTCCAAACACGCTAGAGAAAGATGCCGCAGCTCGCATCCGGCCACTACTAAACTTGCTGAAGATTACTGGCGGTCAGTATATTCACGT
TGGACGAGATGTTGCTCTCGACGAAGCGAGTGTCGCGTGCCGCTCGCGTCAAGGCCGCCACATGATCGTGTATAATCCCATGAAGCCGACGGGAAAATAT
CATTTCAGGCTGTACATGGTGTGCTGCTCTTCGACGTGGATCGCGTTGAATTACAAGCTTCACTGCAACCGGAGTGACGTTTTGGACAGACTGAGTGGTG
TAGTCGATCGAGCTGATGCCCAAAACTTGAGCGAGGAGCTGGAGAAAGTATCGAAAATCCGACAGCATGTGCTAGAGGTGACGAGGCCACTGTTTGGAAC
GAACCGCGTCGTCAATATGGACAACTATTACACCTCCGTTCAACTGCTCCAGGAGCTTCGGCTGAAGGGGCTTTATGGCCGAGGCACCATCCGAGCAAAT
AGCAAGCACTATCCAGCTCACACTATACTGCACAAGGACGACTGCACCCGTGGAGACTATCGCCAGTCTGTCTCGCACGACCACAGTATGCTGGCAGCGT
CGTGGTGTGACGGAAATGTCGTCAACTTGGTTTCAAATGCTGACTCTACAAATGCTACCACTGTCGTCCGCATGGTTGGCAACGAAAGCCAGTCGTTTCC
TGCTCCAGAATGCGTCGCTCAGTACAACGCCAACATGCAAGGTGTCGATAGGTTGGACCAGATAAGAGGAAGATTCTCTACTGCGGACGGTCATTCCTTC
AAACGCTGGCACAAGAAGCTGGCCTTGCGCTGATTGACGTGGCGAGGTCCAATGCGTATCTTACGCGACGGCTGGTAACCTCAGAGCCGACGACTCGTGA
TCCACATCGAGGTTTTGTGATGGAGCTGGTTGGTGAACTTCTGAATGGTCAATGGAGGAATGCACCCAGTGACGGCCGCATGCTTTACAGTGGAGAAATG
CTTGACGAAGCCGAAGCGGAGCAGGTGGGCACACTTTCTTCGCAGCGACCTGCTGATAAAGCTGCTGGGGTTGCGATGGTTGCGTGCACATCAGTGTCGT
CTAGGTAAATTCATGCAGAGAAGAGCAGGAAGCGGCGGCGCTGTATTGTTTGCAGATGGGAGGGGAGATATCCGACTGAAGTCACAAACTATTGCCTCGC
ACATGGCGTGTGCTTGTGCCGCGTTGTGCACGACCATCCTGCCAAGCCGTGGATGAGTCCGGCCACGACTTCCACTTGCTGGGATAAATTCCACCAGTTC
TACTACCCCAACGGGCTGTTTACCGACAAAGGAAACGTGCGACGACACTCCAATCTTGCGAAGCTGAAGGAGGCACATGAACCTAAATTTGACGTCACAC
AGCGGCCTACTGCTGCTTGCCAAAGCGGTGGCGGATCCATTGATGCTCCTATCACACGTAGACTGGGTGGTGGTGCCGCTCTCGGTCACACCAGCGATAC
AGATCGGTTCGTCGGGGGTGGTGGCTCGGTTGGCCTTGAGGCGTTTGGACTTGGTAGCGGTTCCGCTCCCAGCTTGGTCGCGTACGGTGGCTCTGCGCAT
GGCCTTGGTGGCGGTGCTGCTCGCGGACTTGGAGGCGGTGCTGTTGGTCGCAGACTTGGAGGCGGCGCTGCTCGAGGACTGGCTTTCGGCGGCACAGACA
CCAGACCTGGCGGCGTGACAGCTACAGACGGCGGTGCTGAGGACGGACTTGGCGGTGGCTCTGCGCATGGCCTTGACGGCGGTGCTGCTCGCGGACTTGG
AGGCGGTGGTGCGAGAGCACTGTCCCTCGAGGATTGGCTTTCGGCGGCACAGACACCAGACCTGGCGGCGCGACAGCTGCAGACGGCGGTGCTGAGGACG
GACTTGGCGATGGCTCTGCGCATGGCCTTGACTGCGGTGCTGCTCGCGGACTTGGAGGACTGGTTTCGGCGGCACAGACAACAAACGCGGTGGCGATACA
TCTATAGACACAGGTGCTGCGCGCGGTTGTAGTGGTGATGTCGCGTAAGCACGTGATGAAGTTGTTCGTACACGTGGCAGCGGTGGTTTGAATAAGTATA
GACGAGCAGTGTAGGGCTAATATTTCCTAGAGTATATGTAAACAGGCTGAGGCGTCGACTTCCAGCTACAATGTACATCGATCTCCCTCACCAAACTCCA
GTACTCGCAATACGGCTCGGTGCACGTGGAGCGATGTCTTGGGCAAAACTGCGATGTTGATACAGTGATACGTGCCATTAGCATTGCGCTTAGCTCTCGC
AAAACGACCAACTTCGCATCTTCTTCGAACAAAATATGTTCGCAAACACGATGGTTGCTTCACAAATGGGAGGGTGTCTTGACAGCGAAACATCCCGAAC
GTCTGTTTGCTTCAGTATCACCTTACGAAGCAGTGGTTGGCGCTCGAGATGTTGTTGTACACAGCTTTGGCCAAGTGCAACTAGATCCTTTCGAAGCTCG
ACGCCAATGCACGTTCTAACGCTCGTCGCAAGTGCAACTTGAGCGACAATGTTGCCCACACCAGCTCCAACGTCGAGGAAAACGTCGGCTTCTCCGAGGG
GTCCAACAGCTTCAAGTATCTTTGAGACACCCGACGGTAACACCTCACCAGCATTGCCATAAGTACGGCCGGCTTGCTGGCGGACATCGTGCGCACTGAT
TCCTGCAAATATGAGATTCACAGCTTTCGCTGCTTGCCCTGGGTTGAGTATAGTTTCACGTGACTCAGCGGCGACGCAGCCCGCGAAGGTGGTACTGCCC
ACAGACTTGAATATGGTGTGGCTCGCCGGC