Description :
From Genome Similarity Track
Location :
contig_2:161088- 168456
Transcript NameFunction/comments
g519.t1XP_024576042.1 atp-dependent chaperone [Plasmopara halstedii
g520.t1hypothetical protein
g521.t1XP_009523090.1 hypothetical protein PHYSODRAFT_492911 [Phytophthora sojae
g522.t1RAW38487.1 hypothetical protein PC110_g5277 [Phytophthora cactorum
g523.t1RAW38494.1 Protein farnesyltransferase subunit beta [Phytophthora cactorum
g524.t1XP_009523086.1 hypothetical protein PHYSODRAFT_488328 [Phytophthora sojae

Sequence
7368 bases(100 bases per row)
CCACCCGAAGGTTTTGAACATTTTGCTGCAAGTGCTCGATGATGGGCGTTGACGGACTCTCACGGACGCACGGTCGACTTCGCCAACACGGTGGTTATCA
TGACGTCGAACATTGGCGCTGAGCATCTTCTCTTCGAGAACGACTTCGCGTCTCGTGCCAGCAAGAAAATCAAGACGGAGAACGACTTTGTCGAGTCCGA
GAGTGACACCAAGAAGGAGTTCGCGAAGCAGCGCGAGTTGGTGCTGCAGCAGCTGCGTCACACGATTCGTCCGGAGCTGCTGAACCGCCTGGACGACATT
GTCGTGTTCGAGCCACTGGGCCGCAAGGAGCTGCGTCAGATCGTGCTGCTGCAGTTCGAATCCGTCATTAGCCGCCTGAAGGAGGCGCAGATCTCGGTTA
ACGTGACGACGAGCGCGCTGGACGTGATCTTGGACGAGTCCTACGAGCCGCAGTACGGCGCGCGTCCTATCAAGCGGTACATCGAGAAGCACGTCGTGAC
GGACCTGAGCAAGCTCATTATCTCCGGGCAGCTGCACGCAAAGACCCACGTGGAAGTCACGGAGATCGGCGGCAAGCTGTCGTTCGACGTCACCCAGCCC
ATGGACGCCGACGTCGAGATGGCTCCGTAAGAAGAAGGCGACAGTTCGCTAGATATTTTGATTGATATACGTACAAGTTTGCATTTTGAAGTGCCTTGAA
GTTGCTTTGAACATTGGCTGCCAAACCATTTCCATTTTTGAAACGTGTCATGTGCTTCAACTTTAATTATCAAAGGTACATGTGCATTCGTTCATGCTTT
CTTTCTAACGTAATTTCAGTTAACATATGTTATTACAGAGGTTTTCACTGCTGTCAACTAAACAAACGAAAAGCAGCGTCGAAGGCAAGCTCGCGCCATT
CCTGCATTCCCTCGCTGCCGCCCACGCGTCTCCTCCTTCCCCCAGCCCCTTCACCATGGTGCAGTCCCGCAAGATCGTGTGCCAGAAGCTGTCCACTAAC
TTCCGCGAGTGCACGGCCATCGTGCCGTTCCAAGTGCCGGCGCTCAAGCAGGGCGAGGTGCTGGTCAAGACCAAGTACGTGGGGATCAATGCGTCCGACA
TCAACTACACCAACGGCGCCTACCTGCCGGGAGTGCAGCCGCCCTTCGACTGCGGCTTCGAGGCCTGTAAGACTCTTTAGATCTTATATCTTCCAGGCCT
GTTGACTAACCTGTGTCTCTTGCAGTGGGCGTTGTGCTCGAGGTCGGGCCGGGCGTGACTAAGATCAAGAAGGGCGACGCCGTGGCCTCCACGTGTGAGT
GACGAACTGTCAACATGTATGCAATTGGCCGTAAACTTACATCTTGCTCGTGCTTTGGACGCTAGCTTACGGCGCTTTCTCAGAGCACCTAATAGCCCAG
GAGCGTTTCTTGGTCAAGGTTCCTGCTGCAGTCCCAGAGGTGATGCCTATCATTGTGTGCGGTCTCACCGCGTCGATAGCGCTCGAGCACGTGGGCAACA
TGACGCACGGGGAGACGGTGCTGATCACTGCTGCTGCTGGCGCCACGGGCCAGTTCGCCGTGCAGCTGGCCAAGCTCGCCGGCAACCACGTGATCGGTAC
GTGCAGCTCGCCTGACAAGGTGGAGTACCTGCGCTCCATTGGCTGCGACCGCCCCATCAACTACCGTGAGGAGAAGGTGTACGACGTGCTCAAGAAGGAG
TACCCGCGCGGCGTGGACCTCGTGTTCGAGAGCGTGGGCGGCGAGATGTTCGAGGCGTGCGTGAACAACATTGCGCGCAAGGGGCGCATCATCGTCATCG
GAGCCATCGCTGGCTACCAGGACTCGAGCACGTGGAAGCACAAGCCCAACAAGGCTACGACGCCGCTGCCATCCAAGCTGCTGGCTAAGTCGGCATCCGT
GCGCGGCTTTTTCTACAACGACTACTTCCGCGAGACCCAGGCGCACACCAAGAAGCTCACGATGCTCGTGCAGCGCGGCGTGCTGAACGCCGGCGTGGAC
CCGTCCAACTTTTACGGCCTCGAGGACATCCCCAACGCCATCGACTACATGTACGAGCGCAAGAACATCGGCAAGATCGTCGTGGACCTCAACAAGGGCA
CCCCCAAGCTGTAAAGTCTCTTGGTCAGCGTAGTGTAGCCATTTAGCACTCGCGACTATACGTAACGCAAGCCATTTTACTAGTCGCACTTAGATCAGCC
ATCTACGGTACAGCTCGTACGTCATCATGGCTGCCCAGCAACACGTGGGGTGGTGAGCACTCTCACTTTGCAATTGGAGAGCATGGCGACGAAGCTCCGG
ATTCCGATCATCACGTTCAAGGACGGACTGGCAGACGCCGTGAAGCAGCGGTTGCTGGCGACGGACTCTCCTGCTAGATCTCTGTTCCAGGCTGGCGGAC
TGGAGTTCGTGACGCTGCCCCTGCCAACGTTCCCTCCATCTCACGGCGTGCAGGCTGCTGCTCCAGGTGCCAAGGCCGATGCGGACGAAGCTGCGTTAGT
GGAAACCAAGTGGGAGCTCACGGAAGAGCACCAGGAAGTGCTGGCACAGGCGACGATCGTGCTGGGCGACGCGCACAACTGCGCACCGCTGCTGCTGACT
CCGGGGACTGGGCTGCCCTGGAGTATGCAACATTTGCTCACGAACGTGCAGTGGGTGCAGGGAACGTATGCTGGGGTTGAGCAGTACCTGAAGCTACGGG
AAGAAGGTGCTCCGCTACCTTCGTTCCAGCTGACACGCGCCGGTGGCATCAATGGACTAGCGCAATACGTCTTCGGGTACGTCCGCCGAGTCTTGCTGTT
ATTTGCACGTGATCCTTGTCGTGACTCAATCGACTGAATTATCGGTGTGTGTGCACTGTTGACTGCAGCTGGGTCATAACCTTGGAGCGCAAGTTTCACG
AAGCGTACACGATGCAGCAGCAGAAGGTGTTCGAACCTCAGTCGTTGAGATACCGTTCGTTCCAGTCGGTGACCGTGGGCATCTTGGGGCTTGGATCCAT
TGGTCAAGCTATCGGCAAGCTAGCCAAGCTGGCTGGTTTTAACGTGGTAGGCTTCAAGCGGAAGCTTCGCGGCGATGAGGACGACGTTTTCAAGGACTGT
GCGCACCGCATATCAACAGACCTAGAAGATGTTCTGCGGACGTCAGACTATATCGTAGGCATCTTGCCAAGCACGCCGGCGACCAAGTATCTGCTGAACG
AGACGAATCTCCACGTGTGCTCGGAGAAGAAGCCCGTTTTCATCAACGTAGGGCGTGGCGATGTCATCTCCGAGAAAAGCATCGTGCACGCGCTCGACAA
CCAGTGGTTCTCCAAGGTTGTGGTGGACGTGTTCGAGAAGGAGCCGCTGCCCAAGGACAGCCAGCTGTGGGACCATCCCAAGGTCTTCCTGACTCCACAC
GTTGCCGCCTACTGCTTCAACGAGGACATCGCCGACGTGTTCGTGCCGAATCTCAACGCGTACATCGCCAACCAGCCACTCCAATACCAAGTGGACTGGG
CCAGCGGCTATTAGTTGGTCTGGTCATGTTGAAGTGATACCACCTGCTTTTGTCACGCGAATCTACCTTTTTCTGGCAATCGTTTATTCACTAAATAGTG
TTCCCACATTTTTTGATCATGAGCAGCGAGACGCTGGAATTCGCGGCGATGGAGCGCTACCGCTTCCGTAACGACGGTCTGGAGACGCGCACGTCCGCGG
ACCAAGAGGAGTGCGAGGCCAGCTGCAGCCTCTTCTACTTCCCGCTGCTGGAGCTTCCACTGGACCAGCAGTTGCAGCTGCAGCAGCTGAGTTTCATCAA
CACGAATCTCGAGGCATGTTTTAACGTTGTTTTATCTTTTTTAATTCAGGGTTCTAATTGGGTTTATATGTTTTAATAGCCGCTGTTAATGAGGGAGAAT
CATATCGCGTACTTGAAACGCGGCCTCACGCGACTTTCGTCGGGTTTCGTGGCTCTCGACGCAAGGTATCTGGAACAATGTTTCAGTTTGAAAAGCTGCT
GAAATCAGAGTTTTAATGCGCCGAAACGACTGGCGAAATGATTTTACTTTGCAGTCGACCGTGGATTATCTATTGGATCCTTCACGCGTTGGAGCTGCTG
GACGCGCTCCCCGTGGAAGAGACGGAGCGTGTCATCAGTGAGAAATCATGAGTTTAAAGGCTGTTGCTGCAGCAGAGACTGACACTTTCTCTGGTGTTTG
TACAGGAACGCTGAAACCTTGCTGGAACAACGACCATGACGGCGGCTTTGGAGGAGGTCCCAAGCAGTTGGGTCACACAGCCACTAACTACGCGTCGTGC
TTGACACTCGCTCTGCTGGGAACACCCGAGGCGTTGGAGACGGTTGACCGTCAGGCGCTGTACCGGTTCTTCCTCTCGCGGAAACACGCGGCCACGGGAG
CCTTCACAGCTCACGATGGAGGGTGCGTGGCGCTGTGGTTTTGCTGTATTAAGCAGCTTTGCGTGTAATTAAACGGTCTTCTCTGTGCCCAATCTGACAG
GGAAGTGGATGTCCGCGTGACGTACTGCGTCATCTCCATCGCTAACTTGTACGGTATCCTGACGGATGAACTGAAGGCTGGCGTGGTGGACTATGTGCTG
TCCTGTCAGACGTACGAGGGCGGCTTTGGTGGCGAGCCGGACAACGAAGCCCATGGCGGCTACGCTTTCTGCTCCGTGGCGGCACTCTACATTCTCGAGG
CTGTGGGTCAGATTCGGGACCTTCCTGGACTTCTGCATTGGCTTGCGAATCGCCAGATGCCGTTTGAAGGTGGCTACCAGGGACGCACGAACAAGCTTGT
GGATGGCTGCTACAGTTTCTGGCAGGGTGCAGTGCCAGCATTGCTGGCTGACGTTGTGCGAGAACGGTACGGTGATGACGTGCCGTATCAATGCCATCAA
GAGCAGTTGCAGAAGTACATTCTGCTCTGCGGACAGGAGATTTCTGGCGGACTACGAGACAAGCCCGGCAAGCCGCGTGACCATTACCACTCGTGCTATT
GCTTGAGTGGTTTGTCGGTGGCACAACACGGAGATGGCAAAGGCGAGCCGGTCGTTTTTGGAGATGCATCCAACCTGGTGGCGCGCACGCACCCAGCGTA
CAACATTGGCTACGACAAGGCTATGAAGGCAATCGCATATTTCAAGGCGAAGGGCCCCTTCGAACCGGAGTAGAGCAGGTAAAGTACCATGCCATAGATC
CTGCGCAGAATGGTGCCAAATGGAAGTTTACCTGGTCGATGATCTTAACAAGCATTGCACTAGGCATTCACTTTGTGTTTTTGCGTTGTCATTTGTTATA
AGGGTGGAAGTTTCTCGGCTGTGTCGTCGCCATTAGCATCACTACTAGTATCGTGGTCTTTATGGTTTATGCTACGCAGGGACGATGAGGCTGCCAGCTT
GGGCAAAGGAGGCTGAAAGTTCGAGGTCGATGAGTGTGAGCCGTGGTGAACAGGATGGTGCGAGTGGGGAGATGGATTTACCACAGTTAGCGAGGCTTTC
CGCTTTTCTCGATCCCGGACTGACAAAATCGTAGATGGCGATGAAGCTGCTTCAGTCAGCAAGATTGCCTTCGAGATTGATGATCCACTCCCCACATGCC
GCTGCGCTCTCGCTTTGGCTCGATCTTTCCGCTTCTGCCGCTGCTGGAAAGGGGTCAAGTTCGAGCCCTGACTGCTTGCAGACCCACTTTCCTCGTCGGA
GCTCAAGTTTTGTGGAGAGTTGGAGTGAGTTCCCTGAATGAGGCCGCTGCCTTTCACTGAAAATGGCTGCTGCTTGGGTTTGGCTTGGAGTAGCGTGGGC
TTCAGCTTGCTATGCGCCAGCTTGCCTTTGGGGGATGGCTTCTTGTCGGCTTGTACATTTTCCGAGTTGCTATCTTGAGGAGAAGCACCCAGGTAGTGGT
CAAGTGACATTCCACTCACGTCGGACGTCGGTGCAAGCTTTTTCACCGTTGCAGGAAGCTGAGGTGGCAATGCCCGGAGAGATCCTGCTCTGGGCAGCTT
TTCCTGTGCAATGGCATCGACTTCATTCACGTGGAGATAGTCGCTCAGCGTCATACCCGCGAGCTCAGACGGTGGCTGTGCCTTTGGCGTGGAAGTCTCG
GACTCGTAGTCGTCTTCGTAGTCATCTTGCTCGCTCTTCCGCTCCGATGCTTTGGCACCTCCCGTCGCGAGTATCCGATCCGGGCCATCCTTGTCTTCGC
CTCCGACTTTTTCAGCTGCCATGACGTCGTTGTCGGTCGAGTGTTGAGTAAATGCTGTGACACATGACCGCTCACTTTGTGTGCAGCGAAGTAGTCTTCT
AAGGTGGAACCTGCCAGTGCGTTCCCGTCGTCGCCGTCGCCATTGCAGCCTGTCTGTGTATTCAAATGTTGCTGCTGTCCCTTGCCCATGGTACTGCAAC
CTGGCCGCCATCACCCGATAAGCCTGAATCGAGGGGTGTAACGACCATGCCGAGCTGAGTCGTTTCAAGTCCACTTCAACTTGTTCTGGGTTCGCTTTTA
GGCGAGAATGTGATGCTTAGAGGTGGATGGCAGACTTCACAGCAGGGTAGAATGTTCAACGAGAGAAAGCAGTGACCATTGCGAAACTGTTGTTGATAAG
CTAGCAGGCTGTGTAATACATCAATCAACTCGCGCCGAGTCAAGCAATCTCTAGTCTTTCAAGCTTCGCTGATCCAAGGGTTAAGGACGTCTGGCTGGTA
GATTTCTACGCTGATGAATACCCTGGTGTAAATTCTTGCAATCACCACTGCAGTACCTTGAATCTATGCTGGGTTCTACCGTGTTCAGGATGGCGCTGCC
ACCGCCAAATACACTCAGGTTCGGCAGCTCACGCAGCAAGCTTGTTACCAAACCTGAAAGCTAGTAACCCTTCGTCCAGTCGACTTGGTAACGCACGGGT
TCGCCCTTGAGGTAGCGGTTGAAGTTGTCCAGGAACATGGCTGCCACGTCTTCGGGGAAGACTTTGCCCGACACGTGCGGCGTCAGCAGCACCGAGGGGT
GTTCCCAGAGCTCGCTGTCGTTCGGAAGCGGCTCCTTCTCAAACACATCAAGCACGGCACGCGACAGTGTGCCCTTGTTCAGCGCGTCAATCAGTGTTTT
CTCCGAGATGACGTCTCCACGGCCAATATTGATGAACACAGGACTGCGCGCGCGGCATTTCTCCAGGTTCTCCTCGTTCAATAGATACCGTGCGTTTGTG
CTCGGAAGAACGTTGAGCAGGTAGTCGCTCTTGGATAGCAGGTCGTCTAGACTCGTGGTGATGTGATCCGCGCACTCTGCAAGCTCAGCAACGTCCTGTG
CACTCACGTGGCGCTTGAACCCCAGCACTTTGTAGCCGCAGCTGCGCAGCATCTTGCCCGTGTACTGG