Description :
From Genome Similarity Track
Location :
contig_37:1610- 8533
Transcript NameFunction/comments
g9300.t1hypothetical protein
g9301.t1POM79026.1 Reverse transcriptase [Phytophthora palmivora var. palmivora

Sequence
6923 bases(100 bases per row)
TGTGGTGGTCCTGCCGAACCGCGTCTCAATCGGATATCGCTCCGAAAGTGGATTTTTCGATGTTTGCAAGTCCATGGACACTAATTTGAAACACACCATG
CGTTCATGCTACTAGCATTCAACTATTTTGCATCGGAAAATGCGAGACGCACGCTCTACGTGAAAATGAATGTTAAACGACAGGCGTTAAAAGCCGCAGA
GATTACTCGCTCTACTGTCCTAGAGGCCATACAATATTTCAATCACTTGACCGTCTGTCGTTCAAGAGGCATCAAGCCGCACCCGCCATCTCTTGCAGTA
CAACGTGTGATCGATCTAAGAAAGAGTCTACATGTACCGGAGTCTGTCTTTTATGGCTTAAGCAATGGGCTGATGCTGGCTCATCACGACTTGTTCGATC
TGAAGAAGTGGTTTGGACCGCTACAAATTGTTTTCACGGTATCACCTGACTCTGCCGGAACGTGTAGCATTGCAATCAAGTCCGGTAGGGTGACTGAAGT
GGTGATCAGACACGCAAACGTAGCACTGTTACCCAAAAGAGCTGCATTAAAGGCAATAACCGCTCTGCACCCGGTCTAATGTGCGCAATACTTCCTGTGA
ATGATGAAAAACACAATTGAGGTATTGTTGGGATGGGAACCAAAGGCGCATGCGTCAAAGTATGAAGGAGTCATCTTTGGCGTCGTGCGAGCATTTGATG
ATGCAACCGAGACTGAAATCGCTGGTGACTTGCATAGTGTGGCTGTATGAGTTCCCTGCTACTTCAGAGGCTTACAATGAGGCATTGGAAAAGAACCCAA
CTATCCAGCAGCAAGTTGTGTTACTGGCCGACAACGTTCTCTCTACGAAACCGCCTTGCATTGTGAACGAGCTCAGATGTCCCTAATTGTTTAGCAGAAG
ATTCGCTGCAGCCAATTGTTCCAGACGTTGATGCTTTCCGCCGCCCTGCTCCTGGGGCCTCTCCCCCTGCAACAGCTCAATGCAGCAACTGCGACCAAAT
TTTCCGTGATAAAGACATAATTAACCCTTTCGCAAGGAGCTGCTATAGATTCTACGAACTATACTATACAAAGTCAAGTCAATTAAACTCAAAGGGCGCA
AAATTCGCCCTTTTAGTTGTCGATAGAGACGGGGCGTGTGTGCAAATCAAACACGATGCAGTTGGCACTAATGATGTCCAACCTAAAAGGGCGCAAAATG
CGCCCTTTTAGATTGCGTTTTGATTGGCTAATAAGTGGATTTTTTGGTGTGATCCAGCTGAAACAGCCCTCTACTACTGTGATTGGTCAAAATGAAATGG
TACAGCGTTCGACCACGGAAAGATAACAGCGAAACTTACGAAGATATTTGCCTCGTCGACCGTTTTCTGGGTGATGACGCGCCAACGTTGGCCGGAGGAT
GATGCTCGGCTTTGGCTTTCGCGTGAGTCTTTCGCGCGCGCCGTTGGCGCGTATATATCGCACCCCTCTCTGTCGGACGCGACTAGTTGGCTATAGCTCT
GTATGTGGCTCGTGTTGTCGCCAGCATTCTCACAGCTAATCGCTTCAGGTACAGCTACACAGCCAATATGTTTGTATTCCCGGCAATGCAGAGCAATGAA
TGTGCGGGTCACTCAAAGGGGGCATATATCTTCGTGTTCGTATGACTCCGTTAAGGTACACTACGTAGTATCTTCGACGCAATACACTGGTGCATATATC
TTGCACACTGTATTATAAAAGGGGGATTGCGTATGAAACGCTTTTCGCGCCAAATCATGGCGCCCAAAGCTTGGTCCCTACCGTCAGACTTAATAGCTTG
TATGTTTGCATTTGTATAAAGAATAAAAACTCATCCAATATCTGTATTTAGAAACCTTTATATTGACCACAAACACACGACACGTATCAGCCTTCCAGCT
GATTCCTTCTCTCATTTCGAAAAAGCCGTATATGGCGGAAGCGCTGCCCGGGCAGAAGCGCAAGCGTACCGGTCCTGTAGGCGCCAGCAAGCGCCGCCGC
GCGGGATCTGGTGTCGATACAACACCGGCGGAGTCCGCCAGCAGTCTCGGAGGTGTTGCAGTGTTCAAGGGCGCGTGGGCCGCGCTGAAGAAAGCAGGAT
GGACATCCAAGAAACCGTCCAGCAAGGGTCTTGACTCGCGTTACAAGTACATTCGGCCTGGGGGGGGAGGCACGATGGTGTAGAGGGTGCTGATTTCCTT
CTCGGCGAGCTGGCCGTGCTGAGGTATGTCGAGTTGGTGCGAAACCGTGACGCCACAGCAGCTGCAGCCGTTCAAGACGCAGGCAAGACGTTATGTCTGT
GCATGCAGCGGTATGGTAAGTGGCTAGGTAGCTGTATGGCTAACGTTGTACTTGTTGGTGGCGTAGGCGTTGGAGCTCAACATGGAGAAGATAGTGGCGA
CGTCGCTGGCAGAGCTGCTGGACAGGCATCCATTGCCAAACGTCGCCGGTAAGGATCTAGGCATGGCGACGCCGATCAGGAAGCCTCAAGCGCTGCAGGT
GCGGTTGCGTCTTGGGAAGTTGGGCTACAACAGCGAGTGGCGCGACTAACGTTGTGTTTGTTGGTGGTTTGGCTAACGGTGGGTGGGTGTTCGTGCATTG
GTAACGCAGAGAATGACGTCAGCTTCGATGAAGTCATGGAAAGCGTCAGTACAGCGGCGGGGGTTGCTCACGACCAAGCCGTAGTGACCGTGCCTCTAGT
GCACGTAGGTAGACGACGAGAAGGTACGGTTCGTCCGGCTGCAAGCGCCGCCAGCCCAGAAGGTGCGACTTGCGACGAAAGGCAGCGTGAGGAATGAGCG
CGTGCCGTGGCTAACTATGGGTTTGGTGTTGATACAGGAGTTGACGGCAGCATCGTTGACATGATCGACGATGTCATGGTAGACGCTGAAGATGCTGCCG
ACCAGGCAGGTGTCGCTGTGCCTATTGAGAGCGAGCGTGGTGGACGTGGTGCGCGTGGTGACGTGGTGCGCGTGGTGGACGCGTGGACGGCTGCTGAGAG
TGCAGCTCGAGCCACAGGTACTAGAAATGCGGTGCTCGATCTCAGAGTACAAGCTGGAATAGATAAGCTAATGGTGTGTTGCTGGTTTTGCAGGAGCTGG
TGCGCGTGGCGGTGATAATGGTGACACGGCTGGCGCAGTCGTTGTGAGCGCTGCTGCTAGCCACGGCGACCGAGTTCCAGCTGGTAGAGTCGCGATCCCG
AATCACCACAGTCTGGGCGAGCAACAGCCAGTGGAGTAACGGGTGCCACAATGACGCCAACACGAACACCACCCATCATGGTGCAGGACGTGTACGTGAG
CAAGCTGGTCGCGTTTTCGCCGGACAAGGAACGATGGATGAAAGCGAAGGTCTATCGGCCTATCGGTGCTGCCTACATTATTGGCCGAGTATACCGCCAA
GTCAAGAAGGGAAAACACGCTTCTCTTTTTCACATTCGTTGGCTGGACAGCCAATTCCAGAGCTCAGTAGAGCACATCAGTGTTGGCATTGTGCAGCTTG
GGATCAAGAACTACGTTGCGTTAACACGAGTAAAGAACCCGGATTGGCGAATACTGGTTCGGCCTGATCCGACGAAGGACATCAACTTCGAGGAGGACGA
CTCGGATTGCGAAGAAGAAGAGGTGTTCGAGGCTTTCGAGCCTACGGAATTGCTTCCAACCTGCCTCGCAGAAGTTGAAGCCGTTCGAAGCATGCGATTT
GTTCCGTCGGGTGAAGTTGCAGTGCCTTCGTACCTGTATCAGCACAGCGACGGATCGACGAATACCTGCTTGCGTCCTGAGTTCATGCACTTGTTCGAGC
ATTCTGCCAGCTCAAGTTTCTTCGCCTACATCCCCCTCTACTTTGGCGCCAAGTTTTGCATGAGACGAACAAGTACGCTGTGGCGAACAACATCCGGATG
ATAAATCCGTTCACTCTCGACGAGCTGATGGTGTTTCTGGGCATTTTGTTTTTCATGGCAATGAACGACAAGGGCGAGTACGCAAACTACTGGGGTGTTC
AAGCCGAAGATCTTATTTTTGGTGGCGTTTCCACATCGCTCGACGCTATCATGTCCCTGCATCGGTTCAAGCTGCTCCGTCGGTGCCTGAGCTTTTATGC
TACTCCAAACACGCTAGAGAAAGATGCCGCAGCTCGCATCCGGCCACTACTAAACTTGCTGAAGATTACTGGCGGTCAGTATATTCACGTTGGACGAGAT
GTTGCTCTCGACGAAGCAAGTGTCGCGTGCCGCTCGCGTCAAGGCCGCCACATGATCGTGTATAATCCCATGAAGCGGACGGGAAAATATTATTTCAGGC
TGTACATGGTGTGCTGCTCTTCGACGTGGATCGCGTTGAATTACAAGCTTCATTGCAACCGGAGTGACGTTTTGGACAGACTGAGTGGTGTAGGCTATCG
AGCTGATGCCCAAAACTTGAGCGAGGAGCTGGAGAAAGTATCGAAAATCCGACAGCATGTGCTAGAGGTGATGAGGCCACTGTTTGGAACGAACCGCGTC
GTCAACATGGACAACTATTACCCCTCCGTTCAACTGCTCCAGGAGCTTCGGCTGAAGGGGCTTTATGGTCGAGGCACCATCCGAGCAAATAGCAAGCACT
ATCCAGCTCACACTATACTGCACAAGGATGACTGCACCCGTGGAGACTATCGCAAGTCTGCCTCGCACGACCACAGTATGCTGGCAGCGTCGTGGTGTGA
CGGAAATGTCGTCAACTTGGTTTCAAATGCTGACTCTACAAATGCTACCACTGTCGTCCGCATGGTTGGCAACGAAAGCCAGTCGTTTCCTGCTCCAGAA
TGCGTCGCTCAGTACAACGCCATTATGCAAGGTGTCGATAGGCTGGACCAGATAAGAGGAAGATTCTCTACTGCGGACGGTCATTCCTTCAAACGCTGGC
ACAAGAAGATGGCCCTTGCGCTGATTGACGTGGCGAGTTCCAACGCGTATCTTACGCGACGGCTGGTAACCTCAGAGCCGACGACTCGTGATCCACATCG
CGGTTTTGTGATGGAGCTGGTTGGTGAACTTCTGAATGGTCAATGGAGGAATGCACCCAATGACGGCCGCATACTTTACAGTGGAGAAATACTTGGCGAA
GCCGAAGAGGAGCAGGTGGGTACACTTTTTTCGCAGCGACCTGCTGATAAAGCTGCTGGGGTTGCGATGGTTGCGTGCACATCATTGTCGTCTAGGCAAA
TTCATGCAGAGAAGAGCATGAAGCGGCGGCGCTGTATTGTTTGCAGACGGGAGGGGAGATATCCGACTGAAGTCACAAACTATTGCCTCGCACATGGCGT
GTGCTTGTGCCGCGTTGTGCACGACCATCCTGCCAAGCCGTGGATGAGTCCGGCCACGACTTCCACTTGCTGGGATAAATTCCACCAGTTCTACTACCCC
AACGGGCTGTTTACCGACAAAGGAAACGTGCGACGACACTCCAATCTTGCGAAGCTGAAGGAGGCACATGAACCTAAATTTGACGTCACACAGCGGCCTA
CTGCTGCTTGCCAAAGCGGTGGCGGAGCCATTGATGCTCCTATCACACGTAGACTGGGTGGTGGTGCCGCTCTCGGTCACACCAGCGATACAGATCGGTT
CGTCGGGGGTGGTGGCCCGGTTGGCCTTGAGGCGTTTGGACTTGGTAGCGGTTCCGCTCCCTGCTTGGTCGCGTACGGTGGCTCTGTGCATGGCCTTGAT
GGCGGCACTGCTCGCGTGCTTGGAGGCGGTGCTGTTCATCACGTACTCGGAGGTGGCGCTGCTCGACGACTGGCTTTCGGCGGCACAGACACCAGACCTG
GCGGTGCGACAGCTACAGACGGCGGTGCTGACGATGGATTTGGCGGTGGCTCTGCGCATGGCCTTGATGGCGGTGCTGTTGGTCGCAGACTTGGAGGTGG
CGCTGCTCTCGGAGTTGGAGGCGATGCTGCTGTAGCACTGGGTTTCGGCGGCACAGACAACAAACGCGGTGGCGATACATCTATAGACACAGGTGCTGCG
CGTGGTTGTAGTGGTGATGTCGCGTAAGCACGTGATGAAGTTGTTCGTACACGTGGCAGCGGTGGTTTGAATAAGTATAGACGAGCAGTGTAGGGCTAAT
ATTTCCTAGAGTATATGTAAACAGGCTGAGGCGTCGTCTTCCAGCTACAATGTACATCGATATCCCTCACCAAACTCCAGTACTCGCAATACGGCTCGGT
CCACGTGGAGCGATGTCTTGGGTAAAACTGCGATGTTGATACAGTGATACGTGCCATTAGGATTGCGCTGAGCTCTCGCAAAACGACCAACTTCGCATCT
TCTTCAAACAGAAATATGTTCGCAAACACGATGGTTGCTTCACAAATGGGAGGGTGTCTTGACAGCGAAACATCCCGAACGTCTGTCTGCTTCAGTATCA
CCTTACGAAGCAGTGGTTGGCGCTCGAGATGTTGTTGTACACAGCTTTGGCCAAGTGCAACTAGATCCTTTCGAGCTCGACGCCAATGCACGTTCTAACG
CTCGTCGCAAGTGCAACTTGAGCGACAATGTTGCCCACACCAGCTCCAACGTCGAGGAAAACGTCGGCTTCTCCGAGGGGTCCAACAGCTTCAAGTATCT
TTGAGACACCCGACGGTAACACCTCACCAGCATCGCCATAAGTACGGCCGGCTTGCTGGCGGACATCGTGCGCACTGATTCCTACAAATATGAGATTCAC
AGCTTCCGCTGCTTGCCCTGGGTTGATTATAGTTTCACGTGACTCAGCGGCGACGCAGCCCGCGAAGGCGGTACTGCCCACAGACTTGAATATGGTGTGG
TTCGCCGGCTCGGACGTGGTGTTGACCGCAGACGTAGCTACGGCGGCGATCCCGACACGGTCACCAGCCTCGGCGGAGAGGCGGGGCATGATAACGGAGC
CGCGCACAGACTTGGTGGCAGCG