Description :
From Genome Similarity Track
Location :
contig_37:1610- 8533
Transcript NameFunction/comments
g8876.t1RAW32332.1 hypothetical protein PC110_g11324, partial [Phytophthora cactorum
g8877.t1hypothetical protein
g8878.t1hypothetical protein

Sequence
6923 bases(100 bases per row)
GTTGTGGTGGTCCTGCCGAACCGCGTCTCAATCGGATATCGCTCCGAAAGTGGATTTTTCGATGTTTGCAAGTCCATGGACACTAATTTGAAACACACCA
TGCGTTCATGCTACTAGCATTCAACTATTTTGCATCGGAAAATGCGAGACGCACGCTCTACGTGAAAATGAATGTTAAACGACAGGCGTTAAAAGCCGCA
GAGATTACTCGCTCTACTGTCCTAGAGGCCATACAATATTTCAATCACTTGACCGTCTGTCGTTCAAGAGGCATCAAGCCGCACCCGCCATCTCTTGCAG
TACAACGTGTGATCGATCTAAGAAAGAGTCTACATGTACCGGAGTCTGTCTTTTATGGCTTAAGCAATGGGCTGATGCTGGCTCATCACGACTTGTTCGA
TCTGAAGAAGTGGTTTGGACCGCTACAAATTGTTTTCACGGTATCACCTGACTCTGCCGGAACGTGTAGCATTGCAATCAAGTCCGGTAGGGTGACTGAA
GTGGTGATCAGACACGCAAACGTAGCACTGTTACCCAAAAGAGCTGCATTAAAGGCAATAACCGCTCTGCACCCGGTCTAATGTGCGCAATACTTCCTGT
GAATGATGAAAAACACAATTGAGGTATTGTTGGGATGGGAACCAAAGGCGCATGCGTCAAAGTATGAAGGAGTCATCTTTGGCGTCGTGCGAGCATTTGA
TGATGCAACCGAGACTGAAATCGCTGGTGACTTGCATAGTGTGGCTGTATGAGTTCCCTGCTACTTCAGAGGCTTACAATGAGGCATTGGAAAAGAACCC
AACTATCCAGCAGCAAGTTGTGTTACTGGCCGACAACGTTCTCTCTACGAAACCGCCTTGCATTGTGAACGAGCTCAGATGTCCCTAATTGTTTAGCAGA
AGATTCGCTGCAGCCAATTGTTCCAGACGTTGATGCTTTCCGCCGCCCTGCTCCTGGGGCCTCTCCCCCTGCAACAGCTCAATGCAGCAACTGCGACCAA
ATTTTCCGTGATAAAGACATAATTAACCCTTTCGCAAGGAGCTGCTATAGATTCTACGAACTATACTATACAAAGTCAAGTCAATTAAACTCAAAGGGCG
CAAAATTCGCCCTTTTAGTTGTCGATAGAGACGGGGCGTGTGTGCAAATCAAACACGATGCAGTTGGCACTAAATGATGTCCAACCTAAAAGGGCGCAAA
ATGCGCCCTTTAAGATTGCATTTTGATTGGCTAATAAGTGGATTATTTGGTGTGATCCAGCTGAAACAGCCCTCTACTACTATGATTGGTCAAAATGAAA
TGGTACAGCGTTCCACCACGGAAAGATAACAGCGAAACTTACGAAGATATTCGCCTCGTCGACCGTTTTCTGGGTGATGACGCGCCAACGTTGGCCAGAG
GATGATGCTCGGCTTTGGCTTTCGCGTGAGTCTTTCGCGCGCGCCGTTGGCGCGTATATATCGCACCACTCTCTGCCGGACGCGACTAGTTGGCTATAGC
TCTGTATCTGGCTCGTTTTGTCGCCAGCATTCTCACAGCTAATCGCTTCAGGTACAGCTACACAGCCAGTATGTTTGTATTCCCGGCAATGCAGAGCAAT
GAATGTGCGGGTCACTCAATGGGTGCATATATCTTCGTGTTCGTATGACTCCGTTAAGGTATACTACGTAATATCTTCGACGCAATACACTGGTGCATAT
ATCTTGCACACTGTATTCCAAAAGGGGGATTGCGTATGAAACGCTGTTCGCGCCAAATCATGGCGCCCAAAGCTTGGTCCCTACTGTCAGACTTAATAGC
TTGTATGTTTGCATTTGTATAAAGAATAAAAACTCATCCAATATCTGTATTTAGAAACCTTTATATTGACCACAAACACACGACACGTATCAGCCTTCCA
GCTGATTCCTTCTCTCATTTCTAAAAAGAGCCGTATATGGCGGAAGCGCTGCCCGGGCAGAAGCGCAAGTATACCGGTCCTGTAGGCGCCAGCAAGCGCC
GCCACGCGGTATCTGGTGTTGATACAACACCGACGGAGTCCGCCAGCAGTCTCGGAGGTGTTGCAGTGTTCAAGGGCGCGTGGGCCGCGCTGAAGAAAGC
AGGATGGACGTCCAAGAAACCGTCCAGCAAGGGTCTTGACTCGCGTTACAAGTACATTCGGCCTGGGGGGAGGCATGATGGTGTAGAGGGTGCTGATTTA
CTTCTCGGCGAGCTGGCCGTGCTGAGGTATGTCGAGGAGGTGCGCAACCGTGACGCCGCAGCAGCTGCAGCCGTTCAAGACACAGGCAAGACGTTTTGTC
TGTGCATGCAGCGGTATGGCAAGTGGCTAGGTAGCTGTATGGCTAACGTTGCACTTGTTTGTGGCGTAGGCGTTGGAGCTCAACGTGGAGAAGACAGTGG
CGACGTCGCTAGCAGAGCTGCTGAACAGGCAGTCATTGCCGAACGTCGCTGGCAAGGATCTAGGCATGGCGACGCCGATCAGGAAGCCTCAAGCGCTGCA
GGCGCGGTTGCGTCTTGGGAAGTTGGGCTACAACAGCGAGTGGCGCGACTAACGTTGTGTTTGTTGGTGGTTTGACTAACGGTGGGTGCATTGGTAACGC
AGAGAATGATGTCAGCTTCGATGAAGTCATGGAAAGCGTCAGTATAGCGGCGGTGGTCGCTCACGACCAAGCAGTAGTGACCGTGCCTCTAGTGCACGTA
GGTAGACGACGAGAAGGTACGGTTCGTCCGGCTGCAAGCGCCGCCAGCCCAGCAGGTGCGACTTGCGACAAAAGGCAGCGTGAGGAATGAGCGCGTGCCG
TGGCTAACTATGGGTTTGGTGTTGATGCAGGAGTTGACGGCAGCATCGTTGACATGACCGACGACGTCATGGTGGACGCTGAAGGTGCTGCCGACCAGGC
AGGTGTCGCTGTGCCTATTGAGAACGAGCGTGGTGGACGCGGTGCGCGTGGTGAACGTGGTGCGCGTGGGGGACGCGGTGGACGGCTGCTCAGCGTGCAG
CTCGAGCCACAGGTACTAGAAATGCGGTGCTTGATCTCAGAGTGCAAGCAGGAATAGATAAGCTAATGGTGTGTTGCTGGTTTTGCAGGAGCTGGTGCGC
GTGGCGGTGATAATGGTGACACGGCTGGAGCAGTCGTTGTGAGCGCTGCTGCTAGCCGCGGCGACCGAGTTCCAGCTGATGGAGTCGCGATCCCCGAATC
ACCACAGTCTGGGCGAGCAACAACCAGTGGAGTAACGGGTGCTACAACGACGCCAACACGAACACCACCCATCATGCTGCAGGACGTGTACGTGAGCAAG
CTGGTCGCATTCTCGCCGGACAAGGAACGATGGATGAAAGCGAAGGTCTATCGGCCTATCGGTACTGCCTACATTATTGGCCGAGTCTACCGCCAAGTCA
AGAAGGGAAAACACGCTTCTCTTTTTCAGATTCGTTGGCTGGACAGCCAATTCCAGAGCTCAGTAGAGCACATCAGTGTTGGCATTGTGCAGCTTGGGAT
CAAGAACTACGTTGCGCTAACACGAGTGAAGAACCCGGATTGGCGAATACCGGTTCGGCCTGATCCGACGAAGGACATCAACTTCGAGGAGGACGACTCG
GATTGCGAAGAAGAAGAGGTGTTCGAGGCTTTCGAGCCTACGGAATTGCTTCCAACCTGCCTCGCAGAAGTTGAAGCCGTTCGAAGCATGCGATTCGTTC
CGTCGGGTGAAGTTGCAGTGCCTTCGTACCTGTATCAGCACAGCGACGGATCGACGAATACCTACTTGCGTCCTGAGTTCATGCACTTGTTCGAACATTC
TGCCAGCTCAAGTTTCTTCGCCTACATCCCCCTCTACTTTGGCGCCAAGTTTTGCATGAGACGAACAAGTACGCTGTGGCGAACAACATCCGGATGATAA
ATCCGTTCATTCTCGACGAGCTGATGGTGTTTCTGGGCATTTTGTTTTTCATGGCAATGAACGACAAGGGCGAGTACGCAAAATACTGGGGTGTTCAAGC
CGAAGATCTTATTTTTGGTGGCGTTTCCACATCGCTCGACGCTATCATGTCCCTGCATCGGTTCAACCTGCTCCGTCGGTGCCTGAGCTTTAATGCTACT
CCAAACACGCTAGAGAAAGATGCCGCACTCGCATCCGGCCACTACTAAACTTGCTGAAGATTACTGGCGGTCAGTATATTCACGTTGGACGAGATGTTGC
TCTCGACGAAGCGAGTGTCGCGTGCCGCTCGCGTCAAGGCCGCCACATGATCGTGTATAATCCCATGAAGCCGACGGGAAAATATCATTTCAGGCTGTAC
ATGGTGTGCTGCTCTTCGACGTGGATCGCGTTGAATTACAAGCTTCACTGCAACCGGAGTGACGTTTTGAACAGACTCAGTGGTGTAGTCGATCGAGCTG
ATGCCCAAAACTTGAGCGAGGATCTGGAGAAAGTATCGAAAATCCGACAGCATGTGCTAGAGGTGACGAGGCCACTGTTGGAAACTAACCGCGTCGTCAA
TATGGACAACTATTACACCTCCGTTCAACTGCTCCAGGAGCTTCGGCTGAAGGGGCTTTATGGCCGAGGCACCATCCGAGCAAATAGCAAGCACTATCCA
GCTCACACTATACTGCACAAGGACGACTGCACCCGTGGAGACTATCGCCAGTCTGTCTCGCACGACCACAGTATGCTGGCAGCGTCGTGGTGTGACGGAA
ATGTCGTCAACTTGGTTTCAAATGCTGACTCTACAAATGATACCACTGTCGTCCGCATGGTTGGCAACGAAAGCCAGCCGTTTCCTGCTCCAGAATGCGT
CGCTCAGTACAACGCCAACATGCAAGGTGTCGATAGGTTGGACCAGATAAGAGGAAGATTCGCTACTGCGGACGGTCATTCCTTTAAACGCTGGCACAAG
AAGCTTTGCCCTTGCGCTGATTGACGTGGCGAGGTCCAATGCGTATCTTACGCGACGGCTGGTATCCTCAGAGCCGACGACTCGTGATCCACATCGAGGT
TTTGTGATGGAGCTGGTTGGTGAACTTCTGAATGGTCAATGGAGGAATGCACCCAGTGACGGCCGCATGCTTTACAGTGGAGAAATACTTGACGAAGCCG
AAGCGGAGCAAGTGGGCACACTTTCTTCGCAGCGACCTGCTGATAAAGCTGCTGGAGTTGCGATGGTTGCGTGCACATCAGTGTCGTCTAGGCAAATTCA
TGCAGAGAAGAGCAGGAAGCGGCGGCGCTGTATTGTTTGCAGATGGGAGGGGATATATCCGACTGAAGTCACAAACTATTGCCTCGCACATGACGTGTGG
TTGTGCCGCGTTGTGCACGACCATCCTGCCAAGCCGTGGATGAGTCCGGCCACGACTTCCACTTGCTGGGATAAATTCCACCAGTTCTACTACCCCAACG
GGCTGTTTACCGACAAAGGAAACGTGCGACGCCACTCCAATCTTGCGAAGCTGAAGGAGGCACATGAACCTAAATTTGACGTCACACAGCGGCCTACTGC
TGCTTGCCAAAGCGGTGGCGGATCCATTGATGCTCCTATCAGACGTAGCCTAGGTGGTGGTGCCGCTCTCGGTCACACCAGCGATACAGATCGGTTCGTC
GGGGGTGGTGGCTCGGTTGGCCTTGAGGCGTTTGGACTTGGTAGCGGTTCCGCTCCCAGCTTGGTCACGTACGGTGGCTCTGCGCATGGCCTTGGTGGCG
GCGCTGCTCGCGTGCTTGGAGGCGGTGCTGTTCATCACGGACTCGGAGGCGGCGCTGCTCGAGGACTGGCTTTCGGCGGCACAGACACCAGACCTGGCGG
CGTGACAGCTACAGACGGCGGTGCTGAGGACGGACTTGGCGGTGGCTCTGCGCATGGCCTTGACGGCGGTGCTGCTCACGGACTTGGAGGCGGTGTGTGT
CGAGACTTGGAGGCGGCGCTGCTCGAGGACTGGCTTTCGGCGGCACAGACAACAAACGCGGTGGCGATACATCTATAGACACAGGTGCTGCGCGCGGTTG
TAGTGGTGATGTCGCGTAAGCACGTGATGAAGTTGTTCGTACACGTGGCAGCGGTGGTTTGAATAAGTATAGACGAGCAGTGTAGGGTTAATATTTCCTA
GAGTATATGTAAACAGGCTAAGGCGTCGACTTCCAGCTACAATGTACATCGATCTCCCTCACCAAACTCCAGTACTCGCAATACGGCTCGGTGCACGTGG
AGCGATGTCTTGGGCAAAACTGCGATGTTGATACAGTGATACGTGCCATTAGCATTGCGCTTAGCTCTCGCAAAACGACCAACTTCGCATCTTCTTCGAA
CAAAAATATGTTCGCAAACAAGATGGTTGCTTCACAAATGGGATGGTGTCTTGACAGCGAAACATCCCGAACGTCTGTTTGCTTCAGTATCACCTTACGA
AGCAGTGGTTGGCGCTCGAGATGTTGTCGTACACAGCTTTGGCCAAGTGCAACTAAATCCTTTCGAAGCTCGACGCCAATGCACGTTCTAACGCTCGTCG
CAAGTGCAACTTGAGCGACAATGTTGCCCACACCAGCTCCAACGTCGAGGAAAACGTCGGCTTCTCCGAGGGGTCCAACAGCTTCAAGTATCTTTGAGAC
ACCCGACGGTAACACCTCACCAGCATTGCCATAAGTACGGCCGGCTTGCTGGCGGACATCGTGTGCACTGATTCCTGCAAATATGAGATTCACAGCTTTC
GCTGCTTGCCCTGGGTTGAGTATAGTTTCACGTGACTCAGCGGCGACGCAGCCCGCGAAGGTGGTACTGCCCACAGACTTGAATATGGTGTGGCTCGCCG
GCTCGGACGTGGTGTTGACCGCAGACGTGGCTACGGCGGCGATCCCGACACGGTCACCAGCCTCGGCGGAGAGGCTGGACATGGTAACGGAGTCGCGCAC
GGACTTGGTGGCAGCGCGGTATG