Description :
From Genome Similarity Track
Location :
contig_37:1610- 8533
Transcript NameFunction/comments
g7553.t1hypothetical protein

Sequence
6923 bases(100 bases per row)
CCGAACCGCGTCTCAATCGGATATCGCTCCGAAAGTGGATTTTTCGATGTTTGCAAGTCCATGGACACTAATTTGAAACACACCATGCGTTCATGCTACT
AGCATTCAACTATTTTGCATCGGAAAATGCGAGACGCACGCTCTACGTGAAAATGAATGTTAAACGACAGGCGTTAAAAGCCGCAGAGATTACTCGCTCT
ACTGTCCTAGAGGCCATACAATATTTCAATCACTTGACCGTCTGTCGTTCAAGAGGCATCAAGCCGCACCCGCATCTCTTGCAGTACAACGTGTGATCGA
TCTAAGAAAGAGTCTACATGTACCGGAGTCTGTCTTTTATGGCTTAAGCAATGGGCTGATGCGGCTCATCACGACTTGTTCGATCTGAAGAAGTGGTTTG
GACCGCTACAAATTGTTTTCACGGTATCACCTGACTCTGCCGGAACGTGTAGCATTGCAATCAAGTCCGGTAGGGTGACTGAAGTGGTGATCAGACACGC
AAACGTAGCACTGTTACCCAAAAGAGCTGCATTAAAGGCAATAACCGCTCTGCACCCGGTCTAATGTGCGCAATACTTCCTGTGAATGATGAAAAACACA
ATTGAGGTATTGTTGGGATGGGAACCAAAGGCGCATGCGTCAAAGTATGAAGGAGTCATCTTTGGCGTCGTGCGAGCATTTGATGATGCAACCGAGACTG
AAATCGCTGGTGATTGCATAGTGTGGCTGTATGAGTTCCCTGCTACTTCAGAGGCTTACAATGAGGCATTGGAAAAGAACCCAACTATCCAGCAGCAAGT
TGTGTTACTGGCCGACAACGTTCTCTCTACGAAACCGCCTTGCATTGTGAACGAGCTCAGATGTCCCTAATTGTTTAGCAGAAGATTCGCTGCAGCCAAT
TGTTCCAGACGTTGATGCTTTCCGCCGCCCTGCTCCTGGGGCCTCTCCCCCTGCAACAGCTCAATGCAGCAACTGCGACCAAATTTTCCGTGATAAAGAC
ATAATTAACCCTTTCGCAAGGAGCTGCTATAGATTCTACGAACTACTATACAAAGTCAAGTCAATTAAACTCAAAGGGCGCAAAATTCGCCCTTTTAGTT
GTCGATAGAGACGGGGCGTGTGTGCAAATCAAACACGATGCAGTCGGCACTATGATGTCCAACCTAAAAGGGCGCAAAATGCGCCCTTTTAGATTGCATT
TTGATTGGCTAATAAGTGGATTATTTGGTGTGATCCAGCTGAAACAGCCCTCTACTACTGTGATTGGTCAAAATGAAATGGTACAGCGTTCCACCACGGA
AAGATAACAGCGAAACTTACGAAGATATTCGCCTCGTCGACCGTTTTCTGGGTGATGACGCGCCAACGTTGGCCGGAGGATGATGCTCGGCTTCGGCTTT
CGCGTGAGTCTTTCGCGCGCGCCATTGGCGCGTATATATCGCACCACTCTCTGCCGGACGCGACTAGTTGGCTATAGCTCTGTATCTGGCTCGTTTTGTC
GCCAGCATTCTCACAGCTAATCGCTTCAGGTACAGCTACACAGCCAGTATGTTTGTATTCCCGGCAATGCAGAGCAATGAATGTGCGGGTCACTCAATGG
GTGCATATATCTTCGTGTTCGTATGACTCCGTTAAGGTATACTACGTAATATCTTCGACGCAATACACTGGTGCATATATCTTGCACACTGTATTCCAAA
AGGGGGATTGCGTATGAAACGCTGTTCGCGCCAAATCATGGCGCCCAAAGCTTGGTCCCTACTGTCAGACTTAATAGCTTGTATGTTTGCATTTGTATAA
AGAATAAAACTCATCCAATATCTGTATTTAGAAACCTTTATATTGACCACAAACACACGACACGTATCAGCCTTCCAGCTGATTCCTTCTCTCATTTCTA
AAAAGCCGTATATGGCGGAAGCGCTGCCCGGGCAGAAGCGCAAGTATACCGGTCCTGTAGGCGCCAGCAAGCGCCGCCGCGCGGGATCTGGTGTCGATAC
AACACCGGGAGTCCGCCAGCAGTCTCGGAGGTGTTGCAGTGTTCAAGGGCGCGTGGGCCGCGCTGAAGAAAGCAGGATGGACGTCCAAGAAACCGTCCAG
CAAGGGTCTTGACTCGCGTTACAAGTACATTCGGCCTGGGGGGAGGCATGATGGTGTAGAGGGTGCTGATTTCTTCTCGGCGAGCTGGCCGTGCTGAGGT
ATGTCGAGGAGGTGCGCAACCGTGACGCCGCAGCAGCTGCAGCCGTTCAAGACACAGGCAAGACGTTATGTCTGTGCATGCAGCGGTATGGCAAGTGGCT
AGGTAGCTGTATGGCTAACGTTGCACTTGTTTGTGGCGTAGGCGTTGGAGCTCAACGTGGAGAAGACAGTGGCGACGTCGCTGCAGAGCTGCTGGACAGG
CAGTCACTGCCGAACGTCGCCGGCAAGGATCTAGGCATGGCGACGCCGATCAGGAAGCCTCAAGCGCTGCAGGCGGTTGCGTCTTGGGAAGTTGGGCTAC
AACAGCGAGTGGCGCGACTAACGTTGTGTTTGTTGGTGGTTTGACTAACGGTGGGTGCATTGGTAACGCAGAGAATGATGTCAGCTTCGATGAAGTCATG
GAAAGCGTCAGTACAGCGGCGGTGGTCGCTCACGACCAAGCAGTAGTGACCGTGCCTCTAGTGCACGTAGGTAGACGACGAGAAGGTACGGTTCGTCCGG
CTGCAAGCGCCGCCAGCCCAGCAGGTGCGACTTGCGACAAAAGGCAGCGTGAGGAATGAGCGCGTGCCGTGGCTAACTATGGGTTTGGTGTTGATGCAGG
AGTTGACGGCAGCATCGTTGACATGACCGACGACGTCATGGTGGACGCTGAAGGTGCTGGCCGACCAGGCAGGTGTCGCTGTGCCTATTGAACGAGCGTG
GTGGACGCGGTGCGCGTGGTGACGTGGTGCGCGTGGGGGACGCGTGGACGGCTGCTCAGCGTGCAGCTCGAGCCACAGGTACTAGAAATGCGGTGCTCGA
TCTCAGAGTGCAAGCAGGAATAGATAAGCTAATGGTGTGTTGCTGGTTTTGCAGGAGCTGGTGCGCGTGGCGGTGATAATGGTGACACGGCTGGAGCAGT
CGTTGTGAGCGCTGCTGCTAGCCGCGGCGACCGAGTTCCAGCTGATGGAGTCGCGATCCCGAATCACCACAGTCTGGGCGAGCAACAACCAGTGGAGTAA
CGGGTGCTACAACGACGCCAACACGAACACCACCCATCATGCTGCAGGACGTGTACGTGAGCAAGCTGGTCGCGTTCTCGCCGGACAAGGAACGATGGAT
GAAAGCGAAGGTCTATCGGCCTATCGGTACTGCCTACATTATTGGCCGAGTCTACCGCCAAGTCAAGAAGGGAAAACACGCTTCTCTTTTTCAGATTCGT
TGGCTGGACAGCCAATTCCAGAGCTCAGTAGAGCACATCAGTGTTGGCATTGTGCAGCTTGGGATCAAGAACTACGTTGCGTTAACACGAGTGAAGAACC
CGGATTGGCGAATACTGGTTCGGCCTGATCCGACGAAGGACATCAACTTCGAGGAGGACGACTCGGATTGCGAAGAAGAAGAGGTGTTCGAGGCTTTCGA
GCCTACGGAATTGCTTCCAACCTGCCTCGCAGAAGTTGAAGCCGTTCGAAGCATGCGATTCGTTCCGTCGGGTGAAGTTGCAGTGCCTTCGTACCTGTAT
CAGCACAGCGACGGATCGACGAATACCTACTTGCGTCCTGAGTTCATGCACTTGTTCGAGCATTCTGCCAGCTCAAGTTTCTTCGCCTACATCCCCCTCT
ACTTTGGCGCCAAGTTTTGCATGAGACGAACAAGTACGCTGTGGCGAACAACATCCGGATGATAAATCCGTTCACGCTCGACGAGCTGATGGTGTTTCTG
GGCATTTTGTTTTTCATGGCAATGAACGACAAGGGCGAGTACGCAAATTACTGGGGTGTTCAAGCCGAAGATCTTATTTTTGGTGGCGTTTCCACATCGC
TCGACGCTATCATGTCCCTGCATCGGTTCAAGTTGCTCCGTCGGTGCCTGAGCTTTAATGCTACTCCAAACACGCTAGAGAAAGATGCCGCACTCGCATC
CGGCCACTACTAAACTTGCTGAAGATTACTGGCGGTCAGTATATTCACGTTGGACGAGATGTTGCTCTCGACGAAGCGAGTGTCGCGTGCCGCTCGCGTC
AAGGCCGCCACATGATCGTGTATAATCCCATGAAGCCGACGGGAAAATATCATTTCAGGCTGTACATGGTGTGCTGCTCTTCGACGTGGATCGCGTTGAA
TTACAAGCTTCACTGCAACCGGAGTGACGTTTTGGACAGACTGAGTGGTGTAGTCGATCGAGCTGATGCCCAAAACTTGAGCGAGGACTGGAGAAAGTAT
CGAAAATCCGACAGCATGTGCTAGAGGTGACGAGGCCACTGTTTGGAACGAACCGCGTCGTCAATATGGACAACTATTACACCTCCGTTCAACTGCTCCA
GGAGCTTCGGCTGAAGGGGCTTTATGGCCGAGGCACCATCCGAGCAAATAGCAAGCACTATCCAGCTCACACTATACTGCACAAGGACGACTGCACCCGT
GGAGACTATCGCCAGTCTGTCTCGCACGACCACAGTATGCTGGCAGCGTCGTGGTGTGACGGAAATGTCGTCAACTTGGTTTCAAATGCTGACTCTACAA
ATGCTACCACTGTCGTCCGCATGGTTGGCAACGAAAGCCAGTCGTTTCCTGCTCCAGAATGCGTCGCTCAGTACAACGCCAACATGCAAGGTGTCGATAG
GTTGGACCAGATAAGAGGAAGATTCTCTACTGCGGACGGTCATTCCTTCAAACGCTGGCACAAGAAGCTGGCCTTGCGCTGATTGACGTGGCGAGGTCCA
ATGCGTATCTTACGCGACGGCTGGTAACCTCAGAGCCGACGACTCGTGATCCACATCGAGGTTTTGTGATGGAGCTGGTTGGTGAACTTCTGAATGGTCA
ATGGAGGAATGCACCCAGTGACGGCCGCATGCTTTACAGTGGAGAAATACTTGACGAAGCCGAAGCGGAGCAGGTGGGCACACTTTCTTCGCAGCGACCT
GCTGATAAAGCTGCTGGGGTTGCGATGGTTGCGTGCACATCAGTGTCGTCTAGGAAATTCATGCAGAGAAGAGCAGGAAGCGGCGGCGCTGTATTGTTTG
CAGATGGGAGGGGAGATATCCGACTGAAGTCACAAACTATTGCCTCGCACATGGCGTGTGCTTGTGCCGCGTTGTGCACGACCATCCTGCCAAGCCGTGG
ATGAGTCCGGCCACGACTTCCACTTGCTGGGATAAATTCCACCAGTTCTACTACCCCAACGGGCTGTTTACCGACAAAGGAAACGTGCGACGACACTCCA
ATCTTGCGAAGCTGAAGGAGGCACATGAACCTAAATTTGACGTCACACAGCGGCCTACTGCTGCTTGCCAAAGCGGTGGCGGATCCATTGATGCTCCTAT
CACACGTAGACTGGGTGGTGGTGCCGCTCTCGGTCACACCAGCGATACAGATCGGTTCGTCGGGGGTGGTGGCTCGGTTGGCCTTGAGGCGTTTGGACTT
GGTAGCGGTTCCGCTCCCAGCTTGGTCGCGTACGGTGGCTCTGCGCATGGCCTTGGTGGCGGCGCTGCTCGCGTGCTTGGAGGCGGTGCTGTTCATCACG
ACTCGGAGGCGGCGCTGCTCGAGGACTGGCTTTCGGCGGCACAGACACCAGACCTGGCGGCGTGACAGCTACAGACGGCGGTGCTGAGGACGGACTTGGC
GGTGGCTCTGCGCATGGCCTTGACGGCGGTGCTGCTCCGGACTTGGAGGCGGTGTGTGTCGAGACTTGGAGGCGGCGCTGCTGAGGACTGGTTTCGGCGG
CACAGACAACAAACGCGGTGGCGATACATCTATAGACACAGGTGCTGCGCGCGGTTGTAGTGGTGATGTCGCGTAAGCACGTGATGAAGTTGTTCGTACA
CGTGGCAGCGGTGGTTTGAATAAGTATAGACGAGCAGTGTAGGGCTAATATTTCCTAGAGTATATGTAAACAGGCTGAGGCGTCGCTTCCAGCTACAATG
TACATCGATCTCCCTCACCAAACTCCAGTACTCGCAATACGGCTCGGTGCACGTGGAGCGATGTCTTGGGCAAAACTGCGATGTTGATACAGTGATACGT
GCCATTAGCATTGCGCTTAGCTCTCGCAAAACGACCAACTTCGCATCTTCTTCGAAAAAATATGTTCGCAAACACGATGGTTGCTTCACAAATGGGAGGG
TGTCTTGACAGCGAAACATCCCGAACGTCTGTTTGCTTCAGTATCACCTTACGAAGCAGTGGTTGGCGCTCGAGATGTTGTTGTACACAGCTTTGGCCAA
GTGCAACTAGATCCTTTCGAGCTCGACGCCAATGCACGTTCTAACGCTCGTCGCAAGTGCAACTTGAGCGACAATGTTGCCCACACCAGCTCCAACGTCG
AGGAAAACGTCGGCTTCTCCGAGGGGTCCAACAGCTTCAAGTATCTTTGAGACACCCGACGGTAACACCTCACCAGCATTGCCATAAGTACGGCCGGCTT
GCTGGCGGACATCGTGCGCACTGATTCCTGCAAATATGAGATTCACAGCTTTCGCTGCTTGCCCTGGGTTGAGTATAGTTTCACGTGACTCAGCGGCGAC
GCAGCCCGCGAAGGTGGTACTGCCCACAGACTTGAATATGGTGTGGCTCGCCGGCTCGGACGTGGTGTTGACCGCAGACGTGGCTACGGCGGCGATCCCG
ACACGGTCACCAGCCTCGGCGGAGAGGCTGGGCATGTAACGGAGTCGCGCACGGACTTGGTGGCAGCGCGGTCTGAAGCCTTGGCCTCGACGTCCATGGC
GGCACGGACACCAGACTCAGCTG